GJA5 (NM_181703) Human Untagged Clone

CAT#: SC107351

GJA5 (untagged)-Human gap junction protein, alpha 5, 40kDa (GJA5), transcript variant B



  "NM_181703" in other vectors (4)

CNY 3,656.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GJA5 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATFB11; CX40
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_181703, the custom clone sequence may differ by one or more nucleotides


ATGGGCGATTGGAGCTTCCTGGGAAATTTCCTGGAGGAAGTACACAAGCACTCGACCGTGGTAGGCAAGG
TCTGGCTCACTGTCCTCTTCATATTCCGTATGCTCGTGCTGGGCACAGCTGCTGAGTCTTCCTGGGGGGA
TGAGCAGGCTGATTTCCGGTGTGATACGATTCAGCCTGGCTGCCAGAATGTCTGCTACGACCAGGCTTTC
CCCATCTCCCACATTCGCTACTGGGTGCTGCAGATCATCTTCGTCTCCACGCCCTCTCTGGTGTACATGG
GCCACGCCATGCACACTGTGCGCATGCAGGAGAAGCGCAAGCTACGGGAGGCCGAGAGGGCCAAAGAGGT
CCGGGGCTCTGGCTCTTACGAGTACCCGGTGGCAGAGAAGGCAGAACTGTCCTGCTGGGAGGAAGGGAAT
GGAAGGATTGCCCTCCAGGGCACTCTGCTCAACACCTATGTGTGCAGCATCCTGATCCGCACCACCATGG
AGGTGGGCTTCATTGTGGGCCAGTACTTCATCTACGGAATCTTCCTGACCACCCTGCATGTCTGCCGCAG
GAGTCCCTGTCCCCACCCGGTCAACTGTTACGTATCCCGGCCCACAGAGAAGAATGTCTTCATTGTCTTT
ATGCTGGCTGTGGCTGCACTGTCCCTCCTCCTTAGCCTGGCTGAACTCTACCACCTGGGCTGGAAGAAGA
TCAGACAGCGATTTGTCAAACCGCGGCAGCACATGGCTAAGTGCCAGCTTTCTGGCCCCTCTGTGGGCAT
AGTCCAGAGCTGCACACCACCCCCCGACTTTAATCAGTGCCTGGAGAATGGCCCTGGGGGAAAATTCTTC
AATCCCTTCAGCAATAATATGGCCTCCCAACAAAACACAGACAACCTGGTCACCGAGCAAGTACGAGGTC
AGGAGCAGACTCCTGGGGAAGGTTTCATCCAGGTTCGTTATGGCCAGAAGCCTGAGGTGCCCAATGGAGT
CTCACCAGGTCACCGCCTTCCCCATGGCTATCATAGTGACAAGCGACGTCTTAGTAAGGCCAGCAGCAAG
GCAAGGTCAGATGACCTATCAGTGTGA


Restriction Sites Please inquire     
ACCN NM_181703
Insert Size 2550 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181703.1, NP_859054.1
RefSeq Size 2566 bp
RefSeq ORF 1077 bp
Locus ID 2702
UniProt ID P36382
Protein Families Transmembrane
Gene Summary This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene may be associated with atrial fibrillation. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (B) differs in the 5' UTR compared to variant A. Variants A and B encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...