CD20 (MS4A1) (NM_152866) Human Untagged Clone
CAT#: SC101205
MS4A1 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B1; Bp35; CD20; CVID5; FMC7; LEU-16; MS4A2; S7 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene ORF within SC101205 sequence for NM_152866 edited (data generated by NextGen Sequencing)
ATGACAACACCCAGAAATTCAGTAAATGGGACTTTCCCGGCAGAGCCAATGAAAGGCCCT ATTGCTATGCAATCTGGTCCAAAACCACTCTTCAGGAGGATGTCTTCACTGGTGGGCCCC ACGCAAAGCTTCTTCATGAGGGAATCTAAGACTTTGGGGGCTGTCCAGATTATGAATGGG CTCTTCCACATTGCCCTGGGGGGTCTTCTGATGATCCCAGCAGGGATCTATGCACCCATC TGTGTGACTGTGTGGTACCCTCTCTGGGGAGGCATTATGTATATTATTTCCGGATCACTC CTGGCAGCAACGGAGAAAAACTCCAGGAAGTGTTTGGTCAAAGGAAAAATGATAATGAAT TCATTGAGCCTCTTTGCTGCCATTTCTGGAATGATTCTTTCAATCATGGACATACTTAAT ATTAAAATTTCCCATTTTTTAAAAATGGAGAGTCTGAATTTTATTAGAGCTCACACACCA TATATTAACATATACAACTGTGAACCAGCTAATCCCTCTGAGAAAAACTCCCCATCTACC CAATACTGTTACAGCATACAATCTCTGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTT GCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGAGAATGAATGGAAAAGAACGTGC TCCAGACCCAAATCTAACATAGTTCTCCTGTCAGCAGAAGAAAAAAAAGAACAGACTATT GAAATAAAAGAAGAAGTGGTTGGGCTAACTGAAACATCTTCCCAACCAAAGAATGAAGAA GACATTGAAATTATTCCAATCCAAGAAGAGGAAGAAGAAGAAACAGAGACGAACTTTCCA GAACCTCCCCAAGATCAGGAATCCTCACCAATAGAAAATGACAGCTCTCCTTAA Clone variation with respect to NM_152866.2 |
Restriction Sites | Please inquire |
ACCN | NM_152866 |
Insert Size | 3000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_152866.2, NP_690605.1 |
RefSeq Size | 3594 bp |
RefSeq ORF | 894 bp |
Locus ID | 931 |
UniProt ID | P11836 |
Domains | CD20 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Hematopoietic cell lineage |
Gene Summary | This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript variant. Variants 1 and 3 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221570 | MS4A1 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1 |
CNY 2,400.00 |
|
RC221570L1 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC221570L2 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RC221570L3 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC221570L4 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG221570 | MS4A1 (tGFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1 |
CNY 4,000.00 |