SKP1 (NM_170679) Human Untagged Clone

CAT#: SC100696

SKP1 (untagged)-Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2



  "NM_170679" in other vectors (6)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-SKP1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EMC19; OCP-II; OCP2; p19A; SKP1A; TCEB1L
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_170679, the custom clone sequence may differ by one or more nucleotides


ATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTGGAAATTGCCAAACAAT
CTGTGACTATTAAGACCATGTTGGAAGATTTGGGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCT
ACCAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAGTGGTGCACCCACCACAAGGATGACCCTCCT
CCTCCTGAAGATGATGAGAACAAAGAAAAGCGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGA
AAGTTGACCAAGGAACACTTTTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGA
TGTTACATGCAAGACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCTTCAAT
ATCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACGCAAAGAGAACCAGTGGTGTGAAGAGAAGT
GA


>OriGene 5' read for NM_170679 unedited
CTCCTATAGGGCGGCCGCGAATTCGCACGAGGGCGCTGCGACGCTGTAGTGGCTTCGTCT
TCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAGCCTCCCGCCGGCCGTC
TCCTTAACACCGAACACCATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTT
GAAGTTGATGTGGAAATTGCCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATTTG
GGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCTACCAAATGTGAATGCAGCAATA
TTAAAAAAGGTCATTCAGTGGTGCACCCACCACAAGGATGACCCTCCTCCTCCTGAAGAT
GATGAGAACAAAGAAAAGCGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGAAA
GTTGACCAAGGAACACTTTTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGT
TTGCTTGATGTTACATGCAAGCACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGA
GATTCGCAAGACCTTCAATAGCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACG
CAAAGAGAACCAGTGGTGTGAAGAGAAGTGAAATGTTGTGCCTGACACTGTAACACTGTA
AGGATTGTTCCAAATACTAGTTGCACTGCTCTGTTTATAATTGTTAATATTAGACCAACA
GTAGACAAATGCAGCAGCAAGTCAATTGTATTAGCAGAATATTGTCCTCATTGCATGTTG
TAGTTTGAGCACAGATCCCANACCTACGGNNCAGTTTCTTCTAGTATGAGGGAAAATTNC
TTTTTTCTTTGCTCTGATAAACTGAACGGGGGGTCTCTATAAGGGNCATT
Restriction Sites NotI-NotI     
ACCN NM_170679
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_170679.1, NP_733779.1
RefSeq Size 1486 bp
RefSeq ORF 492 bp
Locus ID 6500
UniProt ID P63208
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, TGF-beta signaling pathway, Ubiquitin mediated proteolysis, Wnt signaling pathway
Gene Summary This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) utilizes an alternate splice site in the 3' coding region, compared to variant 1. This results in a frameshift and slightly longer protein (isoform b), compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...