Nps (NM_001271113) Rat Untagged Clone

CAT#: RN215779

Nps (untagged) - Rat neuropeptide S (Nps)



  "NM_001271113" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti Neuropeptide S (rt); diluted antiserum
    • 500 Tests

CNY 11,025.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215779 representing NM_001271113
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTGGCTCATTAAAACTCAACCTCATCTTAGCTCTGTCGCTGTCCGTGGTACACGTGATTTGGAGTT
ATCCGGTCCTCTCTTCCAAGGTGCCTGGGAAGCCTGATTACTTTCTCATTTTGCTGAGTACCTGCCCAGC
CAGGCTGGAGGGGAGCGACGGGCTAGCTTTTCTAAAGCCAATTTTGGAGAAGACGTCGATGAAAAGGTCC
TTTCGCAACGGAGTCGGCTCAGGGGTGAAAAAAACTTCATTTCGAAGAGCAAAGCAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271113
Insert Size 270 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271113.1, NP_001258042.1
RefSeq Size 270 bp
RefSeq ORF 270 bp
Locus ID 100360071
UniProt ID P0C0P7
Gene Summary May play an important anorexigenic role. Modulates arousal and anxiety as well as increases locomotor activity. Binds to its receptor NPSR1 with nanomolar affinity to increase intracellular calcium concentrations.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...