Hmgn3 (NM_001201354) Rat Untagged Clone

Specifications

Product Data
Type	Rat Untagged Clone
Tag	Tag Free
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >RN215746 representing NM_001201354 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGAAGAGAAAGTCTCCTGAGAATGCCGAGGGCAAAGATGGAGCCAAGCTAACGAAGCAGGAGCCCA CGAGACGGTCGGCCAGATTGTCAGCGAAACCTGTTCCACCAAAACCGGAGCCTAAACCAAGAAAAACATC TGCTAAGAAAGAACCCGGAACAAAGATTAACAGAGCTGCTAAGGGGAAGAAGGAAGAAAAGCAGGAAGCT GGAAAGGAAGGCACAGAGAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001201354
Insert Size	234 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001201354.1, NP_001188283.1
RefSeq Size	857 bp
RefSeq ORF	234 bp
Locus ID	113990
UniProt ID	Q66H40
Gene Summary	Binds to nucleosomes, regulating chromatin structure and consequently, chromatin-dependent processes such as transcription, DNA replication and DNA repair. Affects both insulin and glucagon levels and modulates the expression of pancreatic genes involved in insulin secretion. Regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. Regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. May play a role in ocular development and astrocyte function (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) has an alternate splice site in the 3' region, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.