Atp5mg (NM_212516) Rat Untagged Clone
CAT#: RN212282
Atp5l (untagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G (Atp5l), nuclear gene encoding mitochondrial protein, (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Atp5l; MGC72942 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN212282 representing NM_212516
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAAGTTCATCCGTAACCTCGCGGACAAGGCACCGTCGATGGTGGCGGCTGCCGTGACTTACTCGA AGCCTCGATTGGCCACATTTTGGCACTATGCTAGGGTTGAGCTGGTTCCCCCAACCCTTGGTGAAATCCC TACAGCTATTCAGAGCATGAAAAATATAATTCACAGTGCCCAAACTGGTAACTTCAAACACCTCACAGTT AAGGAAGCTGTGCTGAATGGTTTGGTGGCCACTGAGGTGTGGATGTGGTTTTATATCGGAGAGATCATAG GCAAACGTGGCATTGTTGGCTATGATGTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_212516 |
Insert Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_212516.2, NP_997681.1 |
RefSeq Size | 515 bp |
RefSeq ORF | 312 bp |
Locus ID | 300677 |
UniProt ID | Q6PDU7 |
Gene Summary | Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain. Minor subunit located with subunit a in the membrane.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR212282 | Atp5l (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G (Atp5l), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 3,990.00 |
|
RR212282L3 | Lenti ORF clone of Atp5l (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G (Atp5l), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,080.00 |
|
RR212282L4 | Lenti ORF clone of Atp5l (mGFP-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G (Atp5l), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,650.00 |