Serp1 (NM_030835) Rat Untagged Clone
CAT#: RN211903
Serp1 (untagged ORF) - Rat stress-associated endoplasmic reticulum protein 1 (Serp1), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | RAMP4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN211903 representing NM_030835
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTCGCCAAGCAGAGGATCCGTATGGCCAACGAGAAGCACAGCAAGAACATAACTCAGCGCGGCAACG TCGCTAAGACCTCGAGAAATGCCCCCGAAGAAAAGGCGTCGGTAGGACCCTGGTTATTGGCCCTCTTCAT TTTTGTCGTTTGTGGATCTGCAATTTTCCAGATTATTCAAAGTATCAGGATGGGCATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_030835 |
Insert Size | 201 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_030835.2, NP_110462.1 |
RefSeq Size | 2442 bp |
RefSeq ORF | 201 bp |
Locus ID | 80881 |
UniProt ID | Q9R2C1 |
Gene Summary | may be involved in glycosylation modification of secretory and membrane proteins including glycosylation of MHC class II-associated invariant chain (li) [RGD, Feb 2006] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR211903 | Serp1 (Myc-DDK-tagged ORF) - Rat stress-associated endoplasmic reticulum protein 1 (Serp1), (10 ug) |
CNY 3,990.00 |
|
RR211903L3 | Lenti ORF clone of Serp1 (Myc-DDK-tagged ORF) - Rat stress-associated endoplasmic reticulum protein 1 (Serp1), (10 ug) |
CNY 6,080.00 |
|
RR211903L4 | Lenti ORF clone of Serp1 (mGFP-tagged ORF) - Rat stress-associated endoplasmic reticulum protein 1 (Serp1), (10 ug) |
CNY 6,650.00 |