Hopx (NM_133621) Rat Untagged Clone
CAT#: RN211262
Hopx (untagged ORF) - Rat HOP homeobox (Hopx), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | GIIg15b; Hod; Obl |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN211262 representing NM_133621
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGCGCAGACTGCGAGCGGCCCCACGGAGGACCAGGTGGAGATCCTGGAGTACAACTTCAACAAGG TCAACAAGCACCCCGACCCCACCACGCTGTGCCTCATCGCAGCCGAGGCGGGCCTCACGGAGGAGCAGAC GCAGAAATGGTTTAAGCAGCGCCTGGCGGAGTGGCGGCGGTCAGAAGGCCTGCCTTCGGAATGCAGATCG GTCACGGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_133621 |
Insert Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_133621.2, NP_598305.2 |
RefSeq Size | 1065 bp |
RefSeq ORF | 222 bp |
Locus ID | 171160 |
UniProt ID | Q78ZR5 |
Gene Summary | Atypical homeodomain protein which does not bind DNA and is required to modulate cardiac growth and development. Acts via its interaction with SRF, thereby modulating the expression of SRF-dependent cardiac-specific genes and cardiac development. Prevents SRF-dependent transcription either by inhibiting SRF binding to DNA or by recruiting histone deacetylase (HDAC) proteins that prevent transcription by SRF. Overexpression causes cardiac hypertrophy. Acts as a co-chaperone for HSPA1A and HSPA1B chaperone proteins and assists in chaperone-mediated protein refolding.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR211262 | Hopx (Myc-DDK-tagged ORF) - Rat HOP homeobox (Hopx), (10 ug) |
CNY 3,990.00 |
|
RR211262L3 | Lenti ORF clone of Hopx (Myc-DDK-tagged ORF) - Rat HOP homeobox (Hopx), (10 ug) |
CNY 6,080.00 |
|
RR211262L4 | Lenti ORF clone of Hopx (mGFP-tagged ORF) - Rat HOP homeobox (Hopx), (10 ug) |
CNY 6,650.00 |