Rnf5 (NM_001109025) Rat Untagged Clone

CAT#: RN211028

Rnf5 (untagged ORF) - Rat ring finger protein 5 (Rnf5), (10 ug)



  "NM_001109025" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MGC109637
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211028 representing NM_001109025
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCAGCAGAGGAAGAGGACGGGGGCCCCGAAGGGCCAAATCGCGAGCGGGGCGGGGCGAGCGCGA
CCTTCGAATGTAATATATGTTTGGAGACAGCTCGCGAAGCTGTGGTCAGCGTGTGTGGCCACCTCTATTG
TTGGCCCTGTCTCCATCAGTGGCTGGAGACACGGCCAGACCGGCAAGAATGCCCGGTGTGTAAAGCCGGA
ATAAGCAGGGAGAAGGTCGTCCCTCTTTATGGTCGAGGGAGCCAGAAGCCACAGGATCCCAGATTGAAAA
CCCCACCCCGCCCTCAGGGCCAGCGGCCAGCTCCGGAGAGCAGAGGGGGGTTCCAGCCATTCGGTGATGC
AGGGGGATTTCACTTCTCCTTTGGTGTTGGCGCCTTCCCCTTTGGCTTCTTTACCACCGTGTTCAATGCC
CACGAGCCTTTCCGAAGGGGTGCAGGTGTGGATCTGGGGCAGGGTCACCCAGCCTCCAGCTGGCAAGATT
CCTTGTTCCTGTTCCTCGCCATCTTTTTCTTTTTCTGGCTGCTCAGTATTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001109025
Insert Size 543 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001109025.2, NP_001102495.1
RefSeq Size 1142 bp
RefSeq ORF 543 bp
Locus ID 407784
UniProt ID Q5M807
Gene Summary Has E2-dependent E3 ubiquitin-protein ligase activity. May function together with E2 ubiquitin-conjugating enzymes UBE2D1/UBCH5A and UBE2D2/UBC4. Mediates ubiquitination of PXN/paxillin. May be involved in regulation of cell motility and localization of PXN/paxillin. Mediates the 'Lys-63'-linked polyubiquitination of JKAMP thereby regulating JKAMP function by decreasing its association with components of the proteasome and ERAD; the ubiquitination appears to involve E2 ubiquitin-conjugating enzyme UBE2N. Mediates the 'Lys-48'-linked polyubiquitination of TMEM173 at 'Lys-150' leading to its proteasomal degradation; the ubiquitination occurs in mitochondria after viral transfection and regulates antiviral responses.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...