Babam1 (NM_001006964) Rat Untagged Clone

CAT#: RN210410

Babam1 (untagged ORF) - Rat similar to RIKEN cDNA 5430437P03 (MGC94542), (10 ug)



  "NM_001006964" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Merit40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210410 representing NM_001006964
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGTAGCCGAGGCCAACAGCCCCACTGAGGAGGAGGAAGAGGAAGAGGAGGAAGAAGGAGAGGAGC
CGATTTCAGAGCCCAGGCCTCACACTCGCTCCAATCCTGAGGGGGCTGAGGACCGGGCCATCGGGGCTCA
GGCCAATGTGGGTAGCCGCAGCGAGGGCGAAGGTGAGGCAGCCACTGCAGATGATGGGGCGGCCAGTGTC
CCGGGAGCTGTGCCCAAGCCCTGGCAGGTACCAGCACCAGCATCTGAGGTCCAGATTCGAACACCAAGGG
TCAACTGTCCAGAGAAAGTGATCATCTGTCTGGATCTTTCAGAGGAGATGTCTGTGCCAAAGCTGGAGTC
CTTTAATGGGTCCAGAACAAACGCCCTGAATGTGTCTCAGAAGATGGTTGAGATGTTTGTGCGCACGAAG
CACAAGATTGACAAGAGCCACGAGTTTGCCTTGGTCGTAGTGAACGACGACTCTGCCTGGTTGTCTGGCC
TGACCTCTGACCCACGTGAACTCTGCAGCTGCCTGTACGACCTAGAGACGGCATCCTGCTCCACATTCAA
TTTGGAAGGCCTCTTCAGCCTCATCCAGCAGAAGACTGAGCTGCCAGTCACAGAGAATGTGCAAACCATC
CCACCCCCCTACGTCGTGCGCACCATCCTGGTCTACAGCCGCCCACCCTGCCAGCCCCAGTTCTCCTTGA
CTGAGCCCATGAAGAAGATGTTCCAATGTCCCTACTTCTTCTTCGACATCATTTACATCCACAGTGGCCC
TGAGGAAAAGGAAGACGATATGAGCTGGAAGGACATGTTCGCCTTCATGGGCAGTCTGGACACCAAGGGC
ACCAGCTACAAGTATGCAGTAGCACTTGCTGGCCCCGCCCTGGAGCTGCACAACTGCGTGGCCAAGTTGC
TGGCCCACCCGCTGCAGAGGCCCTGCCAGAGCCACGCGAGCTATAGCCTGCTGGAAGAGGACGAAGAGGC
CGGTGAGGGGGAGGCCACTGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001006964
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006964.1, NP_001006965.1
RefSeq Size 1368 bp
RefSeq ORF 1005 bp
Locus ID 290631
UniProt ID Q5XIJ6
Gene Summary Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). The BRCA1-A complex also possesses deubiquitinase activity that specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX. In the BRCA1-A complex, it is required for the complex integrity and its localization at DSBs. Component of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin in various substrates. In these 2 complexes, it is probably required to maintain the stability of BABAM2 and help the 'Lys-63'-linked deubiquitinase activity mediated by BRCC3/BRCC36 component. The BRISC complex is required for normal mitotic spindle assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1. Plays a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1; deubiquitination increases IFNAR1 activity by enhancing its stability and cell surface expression. Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1 deubiquitination.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...