Cox6b2 (NM_001039085) Rat Untagged Clone
CAT#: RN208702
Cox6b2 (untagged ORF) - Rat cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN208702 representing NM_001039085
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGGGTGTTCAAGCCCAGATGCCTGCTCCAGGCCAATGGACAACGCCGCCCTTCGACCCGCGCTTCC CTAACCAAAACCAGACGCGTAACTGCTACCAGAATTTTCTGGACTACCACCGGTGTGTGAAGACCATGGA TCGCCGCGGAAAGAACACACAGGCCTGCGACTACTATTTCCGTGTATTCCATTCACTGTGTCCCGTCAGC TGGGTGCAGCGCTGGAATGAGCAGATCAAGCAGGGAACTTTCCCAGGCAAAATCTGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001039085 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039085.1, NP_001034174.1 |
RefSeq Size | 483 bp |
RefSeq ORF | 267 bp |
Locus ID | 654441 |
UniProt ID | Q6YFQ1 |
Gene Summary | This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. This protein may be one of the heme-binding subunits of the oxidase (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR208702 | Cox6b2 (Myc-DDK-tagged ORF) - Rat cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), (10 ug) |
CNY 3,990.00 |
|
RR208702L3 | Lenti ORF clone of Cox6b2 (Myc-DDK-tagged ORF) - Rat cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), (10 ug) |
CNY 6,080.00 |
|
RR208702L4 | Lenti ORF clone of Cox6b2 (mGFP-tagged ORF) - Rat cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), (10 ug) |
CNY 6,650.00 |