Bcdin3d (NM_001108751) Rat Untagged Clone

CAT#: RN206088

Bcdin3d (untagged ORF) - Rat BCDIN3 domain containing (Bcdin3d), (10 ug)



  "NM_001108751" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms RGD1306433
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN206088 representing NM_001108751
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCAACCCAGGAATTGTCCAAAGGGGGCGTTGAAGAGGCTGTGGAGGAAGACGACCCGGCAGCTT
TGAAGCCTGGGGCCGCGCCGTTCGGAAATTTCCCTCATTATTCCCGCTTCCACCCTCCCGAGCAAAGGCT
CCGCCTTCTGCCCCCGGAGCTTCTTCGACAGCTCTTCCCTCCCGAGGGTCCCGAGAGGAGGCCGATCCTA
GGGCTCGACGTGGGGTGTAACTCCGGGGATCTGAGCATGGCTCTGTATAAACATTTCCTTTCCCCGCATG
ATGGGGAGACCAGCTCCGGCACTTCCAGAGAACTCCGCCTCCTCTGCTGTGATATAGATCCAGTCCTTGT
GGAGCGGGCTGAAAATGGCTGTCGCTTTCCTGATGCCTTGACCTTTATCACCCTGGACATCATGGATCAA
GAGAGCAGGAAGGTTCCCTTGAGTTCTTTCTTAAGCCAGTTTGGGCGTTCCGTTTTTGACATTGTCTTCT
GCATGTCAGTAACCATGTGGATTCACCTGAACCATGGAGACCGTGGTCTGTGCGAGTTCCTGGCCCACGT
CTCCTCTCTCTGCAGCTACCTCCTCGTGGAGCCACAGCCCTGGAAGTGTTACCGGGCAGCCGCAAGACGC
CTACGCAAGCTGGGACTCCACAATTTTGATCACTTCCGCTCCCTGGCCATCCGAGGTGACATGGCCAGCC
AGATCGTGCGAATCTTGACGCAGGACCACGGGATGGAGTTAGCATGCTGTTTTGGCAACACCAGTTGGGA
CCGAAGCCTTCTTCTCTTCAGAGCAAAGCACACCGAGGAGACTCAGGCAATCCCTGAATCGTCAACCAAA
GAGACAGGGACGGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001108751
Insert Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001108751.1, NP_001102221.1
RefSeq Size 1254 bp
RefSeq ORF 858 bp
Locus ID 363001
UniProt ID D4ABH7
Gene Summary O-methyltransferase that specifically monomethylates 5'-monophosphate of cytoplasmic histidyl tRNA, acting as a capping enzyme. Less efficiently, also methylates the 5' monophosphate of pre-miRNAs, acting as a negative regulator of miRNA processing. The 5' monophosphate of pre-miRNAs is recognized by DICER1 and is required for pre-miRNAs processing: methylation at this position reduces the processing of pre-miRNAs by DICER1. Able to mediate methylation of pre-miR-145, as well as other pre-miRNAs. There is some controversy about the methylation of pre-miR-145, since the dimethylation first described as the specific enzymatic activity cannot be reproduced by a more recent work which observes a monomehtylation of pre-miR-145 but two orders weaker than the methylation of cytosolic histidyl tRNA.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...