United States
Germany
Japan
United Kingdom
China
Bex1 (NM_001037365) Rat Untagged Clone
CAT＃: RN205783
Bex1 (untagged ORF) - Rat brain expressed gene 1 (Bex1), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN205783 representing NM_001037365
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCCAAAGATCAAGGAGCAAAAAATCTCAACATGGAAAATGACCATCAGAAAAAGGAGGAAAAGG AAGAAAAGCCGCAAGATACCATCAAAAGGGAGCCGGTTGTGGCCCCCACTTTTGAGGCTGGCAAAAATTG TGCGCCTAGAGGAGGTCGCAGGCGGTTCCGCGTTAGGCAGCCCATTTCCCACTATAGATGGGACCTGATG CACAGGGTTGGAGAGGCCCAGGGCAGGATGAGAGATGAGAATGTGCAAAGGTTTGGGGAGGATATGAGAC ACCTCATGGGCAAGTTGAGGGAAAGGCAGCTGAGCCATAGTCTGCGGGCGGTGAGCACTGACCCCCCTCA CCATGACCACAATGATGAGTTTTGCCTTATGCCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001037365 |
| Insert Size | 387 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001037365.1, NP_001032442.1 |
| RefSeq Size | 730 bp |
| RefSeq ORF | 387 bp |
| Locus ID | 501625 |
| UniProt ID | Q3MKQ2 |
| Gene Summary | Signaling adapter molecule involved in p75NTR/NGFR signaling. Plays a role in cell cycle progression and neuronal differentiation. Inhibits neuronal differentiation in response to nerve growth factor (NGF). May act as a link between the cell cycle and neurotrophic factor signaling, possibly by functioning as an upstream modulator of receptor signaling, coordinating biological responses to external signals with internal cellular states.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR205783 | Bex1 (Myc-DDK-tagged ORF) - Rat brain expressed gene 1 (Bex1), (10 ug) |
CNY 1,920.00 |
|
| RR205783L3 | Lenti ORF clone of Bex1 (Myc-DDK-tagged ORF) - Rat brain expressed gene 1 (Bex1), (10 ug) |
CNY 6,080.00 |
|
| RR205783L4 | Lenti ORF clone of Bex1 (mGFP-tagged ORF) - Rat brain expressed gene 1 (Bex1), (10 ug) |
CNY 6,650.00 |
