Mt2A (NM_001137564) Rat Untagged Clone
CAT#: RN205601
Mt2A (untagged ORF) - Rat metallothionein 2A (Mt2A), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Mt2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN205601 representing NM_001137564
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACCCCAACTGCTCCTGTGCCACAGATGGATCCTGCTCCTGCGCTGGCTCCTGCAAATGCAAACAAT GCAAATGCACCTCCTGCAAGAAAAGCTGCTGTTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGG CTGCATCTGCAAAGAGGCTTCGGACAAGTGCAGCTGCTGCGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001137564 |
Insert Size | 186 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001137564.1, NP_001131036.1 |
RefSeq Size | 449 bp |
RefSeq ORF | 186 bp |
Locus ID | 689415 |
UniProt ID | P04355 |
Gene Summary | Metallothioneins have a high content of cysteine residues that bind various heavy metals; these proteins are transcriptionally regulated by both heavy metals and glucocorticoids.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR205601 | Mt2A (Myc-DDK-tagged ORF) - Rat metallothionein 2A (Mt2A), (10 ug) |
CNY 1,200.00 |
|
RR205601L1 | Lenti ORF clone of Mt2A (Myc-DDK-tagged ORF) - Rat metallothionein 2A (Mt2A), (10 ug) |
CNY 3,600.00 |
|
RR205601L2 | Lenti ORF clone of Mt2A (mGFP-tagged ORF) - Rat metallothionein 2A (Mt2A), (10 ug) |
CNY 6,650.00 |
|
RR205601L3 | Lenti ORF clone of Mt2A (Myc-DDK-tagged ORF) - Rat metallothionein 2A (Mt2A), (10 ug) |
CNY 6,080.00 |
|
RR205601L4 | Lenti ORF clone of Mt2A (mGFP-tagged ORF) - Rat metallothionein 2A (Mt2A), (10 ug) |
CNY 6,650.00 |