Il17f (NM_001015011) Rat Untagged Clone

CAT#: RN205299

Il17f (untagged ORF) - Rat interleukin 17F (Il17f), (10 ug)



  "NM_001015011" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms IL-17F
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN205299 representing NM_001015011
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGGCTCCTGTGAAACAACCATGGTCAAGTCTCTGCTGCTGTTGATGTTGGGATTTGCCATCATCA
GCTCGGGAGCAGCTCGGAGGAACCCCAAAGTAGGGCTTTCTGCTCTGCAGAAAGCCGGGAACTGCCCTCC
CCTGGAGGATAACAGTGTGAGAGTTGACATTCGCATCTTCAATCAAAACCAGGGCATTTCTGTCCCACGT
GACTTCCAGAACCGCTCCAGTTCCCCATGGGATTACAATATCACCCGAGACCCCGACCGGTTCCCCTCAG
AGATCGCTGAGGCCCAGTGCAGACACTCAGGCTGTATCAACGCCCAGGGGCAGGAAGACGGCTCCATGAA
CTCCGTCCCCATCCAGCAAGAAATCCTGGTCCTTCGGAGGGAGCCCCAGGGCTGTTCTAATTCCTTCAGG
TTGGAGAAGATGCTCATAAAAGTTGGCTGCACTTGCGTCACGCCCATCGTCCACCACGCGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001015011
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001015011.2, NP_001015011.2
RefSeq Size 1290 bp
RefSeq ORF 486 bp
Locus ID 301291
UniProt ID Q5BJ95
Gene Summary Ligand for IL17RA and IL17RC. The heterodimer formed by IL17A and IL17F is a ligand for the heterodimeric complex formed by IL17RA and IL17RC. Involved in stimulating the production of other cytokines such as IL6, IL8 and CSF2, and in regulation of cartilage matrix turnover. Also involved in stimulating proliferation of peripheral blood mononuclear cells and T-cells and in inhibition of angiogenesis. Plays a role in the induction of neutrophilia in the lungs and in the exacerbation of antigen-induced pulmonary allergic inflammation.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...