Set (NM_001012504) Rat Untagged Clone

CAT#: RN203618

Set (untagged ORF) - Rat SET nuclear oncogene (Set), (10 ug)



  "NM_001012504" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Ab1-115
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203618 representing NM_001012504
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCCGAAGCGGCAATCTGCGATCCTGCCTCAGCCCAAGAAACCCAGACCCGTTGCTGCCCCGAAGC
TGGAGGACAAGTCGGCCTCTCCCGGCCTGCCGAAGGGAGAAAAAGAACAGCAAGAAGCAATTGAACATAT
TGATGAAGTACAAAATGAAATAGACAGGCTTAATGAACAAGCCAGTGAGGAAATTTTGAAAGTAGAACAA
AAATATAACAAACTCCGCCAACCATTTTTTCAGAAGAGGTCAGAATTGATCACCAAAATCCCAAATTTTT
GGGTAACAACATTTGTCAACCATCCACAAGTGTCTGCACTGCTTGGGGAGGAAGACGAGGAGGCCCTGCA
CTATTTGACCAGAGTTGAAGTGACAGAATTTGAAGACATTAAATCAGGTTACAGAATAGATTTTTATTTT
GATGAAAATCCTTACTTTGAAAATAAAGTTCTCTCCAAAGAATTTCATCTGAATGAGAGCGGTGACCCAT
CTTCAAAGTCCACCGAAATCAAATGGAAATCTGGAAAGGATTTGACAAAATGCTCAAGTCAAACGCAGAA
TAAGGCCAGCAGGAAGAGGCAGCACGAAGAGCCAGAGAGCTTCTTTACCTGGTTTACTGACCATTCAGAC
GCAGGTGCTGACGAGTTAGGAGAGGTCATCAAAGATGATATTTGGCCAAATCCTTTGCAGTACTATTTGG
TTCCCGATATGGATGATGAAGAAGGAGAGGCAGAGGATGATGATGACGACGATGAAGAGGAGGAAGGGTT
GGAAGACATTGATGAAGAAGGAGACGAGGACGAAGGTGAAGAAGACAATGATGAGGATGAAGGGGAGGAA
GGAGAGGAGGATGAAGGCGAGGATGACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001012504
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001012504.1, NP_001012522.1
RefSeq Size 1519 bp
RefSeq ORF 870 bp
Locus ID 307947
UniProt ID Q63945
Gene Summary Multitasking protein, involved in apoptosis, transcription, nucleosome assembly and histone chaperoning. Isoform 2 anti-apoptotic activity is mediated by inhibition of the GZMA-activated DNase, NME1. In the course of cytotoxic T-lymphocyte (CTL)-induced apoptosis, GZMA cleaves SET, disrupting its binding to NME1 and releasing NME1 inhibition. Isoform 1 and isoform 2 are potent inhibitors of protein phosphatase 2A. Isoform 1 and isoform 2 inhibit EP300/CREBBP and PCAF-mediated acetylation of histones (HAT) and nucleosomes, most probably by masking the accessibility of lysines of histones to the acetylases. The predominant target for inhibition is histone H4. HAT inhibition leads to silencing of HAT-dependent transcription and prevents active demethylation of DNA. Both isoforms stimulate DNA replication of the adenovirus genome complexed with viral core proteins; however, isoform 2 specific activity is higher (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...