Rpl41 (NM_139083) Rat Untagged Clone
CAT#: RN202482
Rpl41 (untagged ORF) - Rat ribosomal protein L41 (Rpl41), (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN202482 representing NM_139083
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGAGCGAAGTGGCGGAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGT CCAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_139083 |
Insert Size | 78 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_139083.2, NP_620783.1 |
RefSeq Size | 467 bp |
RefSeq ORF | 78 bp |
Locus ID | 124440 |
UniProt ID | P62948 |
Gene Summary | structural component of the 60S ribosomal subunit; contains 25 amino acids [RGD, Feb 2006] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR202482 | Rpl41 (Myc-DDK-tagged ORF) - Rat ribosomal protein L41 (Rpl41), (10 ug) |
CNY 1,200.00 |
|
RR202482L3 | Lenti ORF clone of Rpl41 (Myc-DDK-tagged ORF) - Rat ribosomal protein L41 (Rpl41), (10 ug) |
CNY 6,080.00 |
|
RR202482L4 | Lenti ORF clone of Rpl41 (mGFP-tagged ORF) - Rat ribosomal protein L41 (Rpl41), (10 ug) |
CNY 6,650.00 |