Ldhb (NM_012595) Rat Untagged Clone

CAT#: RN202177

Ldhb (untagged ORF) - Rat lactate dehydrogenase B (Ldhb), (10 ug)



  "NM_012595" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Ldh2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202177 representing NM_012595
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAACCCTTAAGGAAAAGCTCATTGCGCCAGTCGCAGACGACGAGACTGCCGTCCCGAACAACAAGA
TTACTGTAGTAGGCGTTGGACAAGTTGGAATGGCTTGTGCTATCAGCATTCTGGGGAAGTCTCTGGCTGA
TGAGCTTGCCCTGGTGGATGTCTTGGAAGACAAGCTCAAAGGAGAAATGATGGATCTGCAGCACGGGAGC
TTATTTCTCCAGACTCCGAAAATCGTGGCTGATAAAGATTACTCCGTGACAGCCAATTCTAAGATTGTGG
TGGTGACCGCGGGAGTCCGCCAGCAGGAGGGGGAGAGTCGGCTCAACCTGGTGCAGAGAAACGTCAATGT
ATTCAAGTTCATTATTCCTCAGATCGTCAAGTACAGCCCCGACTGCACCATCATCGTGGTTTCCAACCCA
GTGGATATTCTTACCTATGTCACCTGGAAGCTGAGCGGGCTACCTAAGCACCGCGTGATTGGAAGTGGAT
GCAATCTGGATTCTGCTCGGTTTCGTTACCTCATGGCCGAAAAGCTTGGTATTCATCCCAGCAGCTGCCA
CGGCTGGATCCTGGGCGAGCACGGGGACTCCAGTGTGGCAGTGTGGAGCGGGGTGAATGTGGCAGGAGTC
TCCCTCCAGGAACTGAACCCAGAGATGGGAACGGACAATGACAGCGAGAACTGGAAGGAGGTGCATAAGA
TGGTGGTGGACAGTGCCTATGAAGTCATCAAGCTAAAAGGCTACACCAACTGGGCCATCGGCCTAAGTGT
GGCTGACCTCATCGAATCCATGCTGAAAAACCTCTCTCGGATTCACCCCGTGTCTACAATGGTGAAGGGA
ATGTACGGCATCGAGAACGAAGTCTTCCTCAGTCTCCCGTGCATCCTTAATGCTCGGGGACTGACCAGCG
TCATCAACCAGAAGCTGAAGGACGATGAGGTCGCTCAGCTCAGGAAGAGTGCGGACACCCTGTGGGATAT
CCAGAAAGACCTCAAGGACCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012595
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_012595.2, NP_036727.1
RefSeq Size 1345 bp
RefSeq ORF 1005 bp
Locus ID 24534
UniProt ID P42123
Gene Summary This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have also been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes X and 9. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (Ldhb) results from translation termination at the upstream UGA stop codon, while the longer isoform (Ldhbx) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (Ldhb), which is localized in the cytosol. Variants 1 and 2 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...