Cxcl12 (NM_001033882) Rat Untagged Clone
CAT#: RN200480
Cxcl12 (untagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 2, (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Sdf1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200480 representing NM_001033882
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGCCAAGGTCGTCGCCGTGCTGGCCCTGGTGCTGGCCGCGCTCTGCATCAGTGACGGTAAGCCAG TCAGCCTGAGCTACAGATGCCCCTGCCGATTCTTTGAGAGCCATGTCGCCAGAGCCAACGTCAAACATCT GAAAATCCTCAACACTCCAAACTGTGCCCTTCAGATTGTTGCAAGGCTGAAAAGCAACAACAGACAAGTG TGCATTGACCCGAAATTAAAGTGGATCCAAGAGTACCTGGACAAAGCCTTAAACAAGAGGCTCAAGATGT GA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033882 |
Insert Size | 282 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033882.1, NP_001029054.1 |
RefSeq Size | 2850 bp |
RefSeq ORF | 282 bp |
Locus ID | 24772 |
Gene Summary | a chemoattractant molecule; involved in cell migration [RGD, Feb 2006] Transcript Variant: This variant (2) lacks an internal exon and uses an alternate penultimate exon, compared to variant 1, resulting in a novel 3' coding region and 3' UTR. It encodes isoform beta which is longer and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200480 | Cxcl12 (Myc-DDK-tagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 2, (10 ug) |
CNY 3,990.00 |
|
RR200480L3 | Lenti ORF clone of Cxcl12 (Myc-DDK-tagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 2, (10 ug) |
CNY 6,080.00 |
|
RR200480L4 | Lenti ORF clone of Cxcl12 (mGFP-tagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 2, (10 ug) |
CNY 6,650.00 |