Bcl2l11 (NM_171989) Rat Untagged Clone
CAT#: RN200312
Bcl2l11 (untagged ORF) - Rat BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 2, (10 ug)
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Bim; BimL; Bod |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200312 representing NM_171989
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAAGCAACCTTCTGATGTAAATTCTGAGTGTGACAGAGAAGGTGGACAATTGCAGCCTGCTGAGA GGCCTCCCCAGCTCAGGCCTGGGGCCCCTACCTCCCTACAGACAGAATCGCAAGCTTCCATAAGGCAGTC TCAGGAGGACCCTGAAGATTTGCGCCCAGAGATACGGATCGCACAGGAGCTGCGGCGGATCGGAGACGAG TTCAATGAGACTTACACGAGGAGGGCGTTTGCAAACGATTACCGAGAGGCGGAAGACCACCCGCAAATGG TTATCTTACAACTGTTACGATTCATCTTCCGTCTGGTCTGGAGAAGGCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_171989 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_171989.1, NP_741986.1 |
RefSeq Size | 333 bp |
RefSeq ORF | 333 bp |
Locus ID | 64547 |
UniProt ID | O88498 |
Gene Summary | proapototic Bcl-2 related protein that interacts with anti-apoptotic Bcl-2 family members to play a role in regulation of apoptosis [RGD, Feb 2006] Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 3. This variant encodes isoform 2, which is shorter than isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200312 | Bcl2l11 (Myc-DDK-tagged ORF) - Rat BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 2, (10 ug) |
CN¥ 3,990.00 |
|
RR200312L3 | Lenti ORF clone of Bcl2l11 (Myc-DDK-tagged ORF) - Rat BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 2, (10 ug) |
CN¥ 6,080.00 |
|
RR200312L4 | Lenti ORF clone of Bcl2l11 (mGFP-tagged ORF) - Rat BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 2, (10 ug) |
CN¥ 6,650.00 |
其它Bcl2l11产品