Nnat (NM_181687) Rat Untagged Clone
CAT#: RN200242
Nnat (untagged ORF) - Rat neuronatin (Nnat), transcript variant 2, (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Peg5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200242 representing NM_181687
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGCAGTGGCAGCAGCCTCGGCAGAACTGCTCATCATCGGCTGGTACATCTTCCGCGTGCTGCTGC AGGTGTTCAGGTACTCCCTGCAGAAGCTGGCGCACACGGTGTCCCGGACCGGGCGGCAGGTGCTGGGGGA GCGCAGGCACCGAGCCCCCAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_181687 |
Insert Size | 165 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181687.2, NP_859015.1 |
RefSeq Size | 1204 bp |
RefSeq ORF | 165 bp |
Locus ID | 94270 |
UniProt ID | Q62649 |
Gene Summary | may play a role in early postnatal brain development [RGD, Feb 2006] Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, which results in a shorter isoform (beta) missing an internal protein segment compared to isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200242 | Nnat (Myc-DDK-tagged ORF) - Rat neuronatin (Nnat), transcript variant 2, (10 ug) |
CNY 3,990.00 |
|
RR200242L3 | Lenti ORF clone of Nnat (Myc-DDK-tagged ORF) - Rat neuronatin (Nnat), transcript variant 2, (10 ug) |
CNY 6,080.00 |
|
RR200242L4 | Lenti ORF clone of Nnat (mGFP-tagged ORF) - Rat neuronatin (Nnat), transcript variant 2, (10 ug) |
CNY 6,650.00 |