Pdx1 (NM_008814) Mouse Tagged ORF Clone

CAT#: MR227421

  • TrueORF®

Pdx1 (Myc-DDK-tagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1)

ORF Plasmid: DDK tGFP



  "NM_008814" in other vectors (6)

Need custom modification / cloning service?
Get a free quote

Mouse Protein / Lysate Request

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (5)
pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag, 10ug
    • 10 ug

CNY 5,420.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
    • 30 ul

CNY 300.00


Pdx1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Mouse Tagged ORF Clone
Tag Myc-DDK
Synonyms IDX-1; IPF-1; Ipf1; Mody4; pdx-1; STF-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MR227421 representing NM_008814
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAGTGAGGAGCAGTACTACGCGGCCACACAGCTCTACAAGGACCCGTGCGCATTCCAGAGGGGCC
CGGTGCCAGAGTTCAGCGCTAACCCCCCTGCGTGCCTGTACATGGGCCGCCAGCCCCCACCTCCGCCGCC
ACCCCAGTTTACAAGCTCGCTGGGATCACTGGAGCAGGGAAGTCCTCCGGACATCTCCCCATACGAAGTG
CCCCCGCTCGCCTCCGACGACCCGGCTGGCGCTCACCTCCACCACCACCTTCCAGCTCAGCTCGGGCTCG
CCCATCCACCTCCCGGACCTTTCCCGAATGGAACCGAGCCTGGGGGCCTGGAAGAGCCCAACCGCGTCCA
GCTCCCTTTCCCGTGGATGAAATCCACCAAAGCTCACGCGTGGAAAGGCCAGTGGGCAGGAGGTGCTTAC
ACAGCGGAACCCGAGGAAAACAAGAGGACCCGTACTGCCTACACCCGGGCGCAGCTGCTGGAGCTGGAGA
AGGAATTCTTATTTAACAAATACATCTCCCGGCCCCGCCGGGTGGAGCTGGCAGTGATGTTGAACTTGAC
CGAGAGACACATCAAAATCTGGTTCCAAAACCGTCGCATGAAGTGGAAAAAAGAGGAAGATAAGAAACGT
AGTAGCGGGACCCCGAGTGGGGGCGGTGGGGGCGAAGAGCCGGAGCAAGATTGTGCGGTGACCTCGGGCG
AGGAGCTGCTGGCAGTGCCACCGCTGCCACCTCCCGGAGGTGCCGTGCCCCCAGGCGTCCCAGCTGCAGT
CCGGGAGGGCCTACTGCCTTCGGGCCTTAGCGTGTCGCCACAGCCCTCCAGCATCGCGCCACTGCGACCG
CAGGAACCCCGG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII      Cloning Scheme for this gene      Plasmid Map     
ACCN NM_008814
ORF Size 852 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008814.4
RefSeq Size 1287 bp
RefSeq ORF 855 bp
Locus ID 18609
UniProt ID P52946
MW 31.4 kDa
Gene Summary Activates insulin and somatostatin gene transcription. Key regulator of islet peptide hormone expression but also responsible for the development of the pancreas, most probably by determining maturation and differentiation of common pancreatic precursor cells in the developing gut. As part of a PDX1:PBX1b:MEIS2b complex in pancreatic acinar cells is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. Binds the DNA sequence 5'-CC[CT]TAATGGG-3'.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...