Pdx1 (NM_008814) Mouse Untagged Clone

CAT#: MC209160

Pdx1 (untagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1), (10ug)



  "NM_008814" in other vectors (6)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Pdx1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms IDX-1; IPF-1; Ipf1; Mody4; pdx-1; STF-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209160 representing NM_008814
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAGTGAGGAGCAGTACTACGCGGCCACACAGCTCTACAAGGACCCGTGCGCATTCCAGAGGGGCC
CGGTGCCAGAGTTCAGCGCTAACCCCCCTGCGTGCCTGTACATGGGCCGCCAGCCCCCACCTCCGCCGCC
ACCCCAGTTTACAAGCTCGCTGGGATCACTGGAGCAGGGAAGTCCTCCGGACATCTCCCCATACGAAGTG
CCCCCGCTCGCCTCCGACGACCCGGCTGGCGCTCACCTCCACCACCACCTTCCAGCTCAGCTCGGGCTCG
CCCATCCACCTCCCGGACCTTTCCCGAATGGAACCGAGCCTGGGGGCCTGGAAGAGCCCAACCGCGTCCA
GCTCCCTTTCCCGTGGATGAAATCCACCAAAGCTCACGCGTGGAAAGGCCAGTGGGCAGGAGGTGCTTAC
ACAGCGGAACCCGAGGAAAACAAGAGGACCCGTACTGCCTACACCCGGGCGCAGCTGCTGGAGCTGGAGA
AGGAATTCTTATTTAACAAATACATCTCCCGGCCCCGCCGGGTGGAGCTGGCAGTGATGTTGAACTTGAC
CGAGAGACACATCAAAATCTGGTTCCAAAACCGTCGCATGAAGTGGAAAAAAGAGGAAGATAAGAAACGT
AGTAGCGGGACCCCGAGTGGGGGCGGTGGGGGCGAAGAGCCGGAGCAAGATTGTGCGGTGACCTCGGGCG
AGGAGCTGCTGGCAGTGCCACCGCTGCCACCTCCCGGAGGTGCCGTGCCCCCAGGCGTCCCAGCTGCAGT
CCGGGAGGGCCTACTGCCTTCGGGCCTTAGCGTGTCGCCACAGCCCTCCAGCATCGCGCCACTGCGACCG
CAGGAACCCCGGTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_008814
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_008814.3, NP_032840.1
RefSeq Size 1287 bp
RefSeq ORF 855 bp
Locus ID 18609
UniProt ID P52946
Gene Summary Activates insulin and somatostatin gene transcription. Key regulator of islet peptide hormone expression but also responsible for the development of the pancreas, most probably by determining maturation and differentiation of common pancreatic precursor cells in the developing gut. As part of a PDX1:PBX1b:MEIS2b complex in pancreatic acinar cells is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. Binds the DNA sequence 5'-CC[CT]TAATGGG-3'.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...