Ifng (NM_008337) Mouse Tagged ORF Clone
CAT#: MR227155
- TrueORF®
Ifng (Myc-DDK-tagged) - Mouse interferon gamma (Ifng)
ORF Plasmid: tGFP
"NM_008337" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 1,200.00
CNY 3,705.00
Cited in 1 publication. |
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | If; If2f; Ifg; IFN-g |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR227155 representing NM_008337
Red=Cloning site Blue=ORF Green=Tags(s) CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACGCTACACACTGCATCTTGGCTTTGCAGCTCTTCCTCATGGCTGTTTCTGGCTGTTACTGCCACG GCACAGTCATTGAAAGCCTAGAAAGTCTGAATAACTATTTTAACTCAAGTGGCATAGATGTGGAAGAAAA GAGTCTCTTCTTGGATATCTGGAGGAACTGGCAAAAGGATGGTGACATGAAAATCCTGCAGAGCCAGATT ATCTCTTTCTACCTCAGACTCTTTGAAGTCTTGAAAGACAATCAGGCCATCAGCAACAACATAAGCGTCA TTGAATCACACCTGATTACTACCTTCTTCAGCAACAGCAAGGCGAAAAAGGATGCATTCATGAGTATTGC CAAGTTTGAGGTCAACAACCCACAGGTCCAGCGCCAAGCATTCAATGAGCTCATCCGAGTGGTCCACCAG CTGTTGCCGGAATCCAGCCTCAGGAAGCGGAAAAGGAGTCGCTGC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_008337 |
ORF Size | 465 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008337.4 |
RefSeq Size | 1207 bp |
RefSeq ORF | 468 bp |
Locus ID | 15978 |
UniProt ID | P01580 |
MW | 18.4 kDa |
Gene Summary | This gene encodes a soluble cytokine that is a member of the type II interferon class. The encoded protein is secreted by cells of both the innate and adaptive immune systems. The active protein is a homodimer that binds to the interferon gamma receptor which triggers a cellular response to viral and microbial infections. Mice deficient in this gene have increased susceptibility to viral, bacterial and parasitic infections and to several autoimmune diseases. [provided by RefSeq, Dec 2015] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Myeloid cell‐based delivery of IFN‐γ reprograms the leukemia microenvironment and induces anti‐tumoral immune responses
,null,
EMBO Molecular Medicine
,PubMed ID 34459560
[Ifng]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC208752 | Ifng (untagged) - Mouse interferon gamma (Ifng), (10ug) |
CNY 1,200.00 |
|
MG227155 | Ifng (tGFP-tagged) - Mouse interferon gamma (Ifng), (10ug) |
CNY 2,800.00 |
|
MR227155L3 | Lenti ORF clone of Ifng (Myc-DDK-tagged) - Mouse interferon gamma (Ifng) |
CNY 3,600.00 |
|
MR227155L4 | Lenti ORF clone of Ifng (mGFP-tagged) - Mouse interferon gamma (Ifng) |
CNY 3,600.00 |