Rnf125 (NM_026301) Mouse Tagged ORF Clone
CAT#: MR220681
- TrueORF®
Rnf125 (Myc-DDK-tagged) - Mouse ring finger protein 125 (Rnf125)
ORF Plasmid: tGFP
"NM_026301" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 1,200.00
CNY 3,705.00
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | 4930553F04Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR220681 representing NM_026301
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGTCAGAATACCAGAACTGTGCTGAGTGTGGAACTCTGGTTTGCCTCAGTGACATGAGGGCGCACA TAAGGACCTGTGAGAAGTACATCGATAAATATGGCCCGCTGCTAGAACTTGGCGACACCACAGCAAGATG TGTATGTCCATTTTGTCAGCGGGAACTGGATGAAGACTGCTTGCTGGATCATTGCATTATCCACCACAGA TCAGAAAGGAGGCCCGTGTTCTGTCCACTTTGCCATTCACGACCTGATGAAAGCCCAAGTACCTTCAATG GCAGTTTAATTAGACATTTGCAAGTCAGTCACACTTTGTTTTATGATGATTTCATAGATTTTGATATAAT TGAGGAAGCCATTATTCGCAGAGTGCTAGACCGCTCACTTCTTGAATATGTGAATCAGTCAAACACCACA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_026301 |
ORF Size | 420 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_026301.3 |
RefSeq Size | 1334 bp |
RefSeq ORF | 423 bp |
Locus ID | 67664 |
UniProt ID | Q9D9R0 |
MW | 16.8 kDa |
Gene Summary | E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins, such as DDX58/RIG-I, MAVS/IPS1, IFIH1/MDA5, JAK1 and p53/TP53. Acts as a negative regulator of type I interferon production by mediating ubiquitination of DDX58/RIG-I at 'Lys-181', leading to DDX58/RIG-I degradation. Mediates ubiquitination and subsequent degradation of p53/TP53. Mediates ubiquitination and subsequent degradation of JAK1. Acts as a positive regulator of T-cell activation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC210593 | Rnf125 (untagged) - Mouse ring finger protein 125 (Rnf125), (10ug) |
CNY 3,990.00 |
|
MG220681 | Rnf125 (tGFP-tagged) - Mouse ring finger protein 125 (Rnf125), (10ug) |
CNY 2,850.00 |
|
MR220681L3 | Lenti ORF clone of Rnf125 (Myc-DDK-tagged) - Mouse ring finger protein 125 (Rnf125) |
CNY 4,750.00 |
|
MR220681L4 | Lenti ORF clone of Rnf125 (mGFP-tagged) - Mouse ring finger protein 125 (Rnf125) |
CNY 4,750.00 |