United States
Germany
Japan
United Kingdom
China
Ccng1 (BC005534) Mouse Tagged ORF Clone
CAT＃: MR203177
- TrueORF®
Ccng1 (Myc-DDK-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034)
ORF Plasmid: tGFP
"BC005534" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 2,470.00
Product images
CNY 300.00
Specifications
| Product Data | |
| Type | Mouse Tagged ORF Clone |
| Tag | Myc-DDK |
| Synonyms | Ccng, cyclin G |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MR203177 representing BC005534
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
|
| ACCN | BC005534 |
| ORF Size | 97 bp |
| OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC005534, AAH05534 |
| RefSeq Size | 3151 bp |
| RefSeq ORF | 749 bp |
| Locus ID | 12450 |
| MW | 115.5 kDa |
| Gene Summary | May play a role in growth regulation. Is associated with G2/M phase arrest in response to DNA damage. May be an intermediate by which p53 mediates its role as an inhibitor of cellular proliferation.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MC218146 | Ccng1 (untagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034), (10ug) |
CNY 6,940.00 |
|
| MG203177 | Ccng1 (tGFP-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034) |
CNY 2,760.00 |
|
| MR203177L3 | Lenti ORF clone of Ccng1 (Myc-DDK-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034) |
CNY 4,370.00 |
|
| MR203177L4 | Lenti ORF clone of Ccng1 (mGFP-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034) |
CNY 4,370.00 |
