Med28 (NM_025895) Mouse Tagged ORF Clone
CAT#: MR201584
- TrueORF®
Med28 (Myc-DDK-tagged) - Mouse mediator of RNA polymerase II transcription, subunit 28 homolog (yeast) (Med28)
ORF Plasmid: tGFP
"NM_025895" in other vectors (3)
Need custom modification / cloning service?
Get a free quote
CNY 2,400.00
CNY 3,705.00
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | 1500003D12Rik; AI451633; AU045690; Eg1; FKSG20; magicin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR201584 representing NM_025895
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGTCCCTGGGAGGGATGTTCACTGGGCAGCCTCCAGGTCCCCCGCCGCCGCCGCCCGGGCTCC CAGGCCAGGCGTCGCTTCTGCAAGCAGCCCCTGGGGCCCCGAGACCATCTAACAGCACTTTGGTGGACGA GTTGGAGTCATCCTTCGAGGCTTGCTTTGCTTCCCTTGTGAGTCAGGATTATGTCAATGGGACTGATCAG GAAGAAATTCGAACTGGTGTTGATCAGTGTATCCAGAAGTTTTTGGACATTGCAAGACAGACAGAATGTT TTTTCCTACAAAAAAGGTTGCAGTTATCTGTCCAGAAACCAGATCAAGTTATCAAAGAGGATGTCTCGGA ACTAAGGAGTGAACTGCAGCGGAAGGATGCGCTGGTCCAGAAGCACTTGACAAAGCTGAGGCATTGGCAG CAGGTGCTGGAGGACATCAATGTGCAGCACAAGAAGCCGGCTGACATGCCTCAGGGATCCTTGGCCTTCC TCGAGCAGGCGTCTGCCAACATTCCTGCACCTCTGAAGCAGACC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_025895 |
ORF Size | 534 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_025895.4, NP_080171.1 |
RefSeq Size | 4568 bp |
RefSeq ORF | 537 bp |
Locus ID | 66999 |
UniProt ID | Q920D3 |
MW | 20 kDa |
Gene Summary | Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. May be part of a complex containing NF2/merlin that participates in cellular signaling to the actin cytoskeleton downstream of tyrosine kinase signaling pathways (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201584 | Med28 (tGFP-tagged) - Mouse mediator of RNA polymerase II transcription, subunit 28 homolog (yeast) (Med28) |
CNY 2,850.00 |
|
MR201584L3 | Lenti ORF clone of Med28 (Myc-DDK-tagged) - Mouse mediator of RNA polymerase II transcription, subunit 28 homolog (yeast) (Med28) |
CNY 4,750.00 |
|
MR201584L4 | Lenti ORF clone of Med28 (mGFP-tagged) - Mouse mediator of RNA polymerase II transcription, subunit 28 homolog (yeast) (Med28) |
CNY 4,750.00 |