Nono (NM_001252518) Mouse Untagged Clone

CAT#: MC227869

Nono (untagged) - Mouse non-POU-domain-containing, octamer binding protein (Nono), transcript variant 2



  "NM_001252518" in other vectors (1)

CNY 4,560.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
NONO Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA407051; AV149256; nonA; NRB54; P54NRB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227869 representing NM_001252518
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGAGCAATAAAGCCTTTAACTTGGAGAAGCAGAATCATACTCCAAGGAAGCATCATCAGCATCACC
ACCAGCAGCACCATCAGCAGCAACAGCAGCAGCAGCAGCAACAGCCACCCCCACCAATACCTGCAAATGG
CCAGCAGGCCAGCAGCCAGAATGAAGGCTTGACTATTGACCTGAAGAATTTTAGGAAACCAGGAGAGAAG
ACCTTTACACAGCGTAGCCGTCTCTTTGTGGGCAATCTTCCCCCTGATATCACTGAGGAGGAAATGAGGA
AACTATTTGAGAAATATGGAAAAGCAGGCGAAGTTTTCATTCATAAGGATAAAGGCTTTGGCTTTATTCG
CTTGGAAACACGAACCCTAGCGGAAATTGCCAAAGTGGAGCTGGACAACATGCCCCTCCGTGGGAAGCAG
CTGCGAGTGCGCTTTGCCTGTCACAGTGCATCCCTTACAGTCCGCAACCTTCCTCAGTACGTGTCGAACG
AACTGCTGGAAGAAGCCTTTTCTGTGTTCGGCCAGGTGGAGAGGGCTGTAGTCATTGTGGATGACCGAGG
AAGGCCCTCAGGGAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCTCTGGACAGATGC
AGTGAAGGCTCCTTCTTGCTGACTACATTTCCTCGGCCTGTGACTGTGGAGCCTATGGACCAGTTAGATG
ATGAAGAGGGACTTCCAGAGAAACTGGTTATAAAAAACCAGCAATTCCACAAGGAGAGAGAACAGCCACC
CAGATTTGCACAACCTGGCTCCTTTGAGTATGAGTATGCCATGCGCTGGAAGGCACTCATTGAGATGGAG
AAGCAACAGCAGGATCAAGTGGATCGGAACATCAAGGAGGCTCGTGAGAAGCTGGAGATGGAGATGGAGG
CTGCACGTCATGAGCACCAGGTTATGCTAATGAGGCAGGATTTGATGAGACGTCAAGAAGAGCTTCGGAG
AATGGAGGAGCTGCATAACCAAGAGGTTCAGAAGCGAAAGCAGTTAGAACTCAGGCAGGAAGAGGAACGC
AGGCGCCGTGAGGAAGAGATGCGGCGACAGCAAGAGGAAATGATGCGCCGACAGCAGGAAGGATTCAAGG
GAACCTTCCCTGATGCGAGAGAACAAGAGATACGGATGGGCCAAATGGCTATGGGAGGTGCTATGGGCAT
AAACAATAGAGGCGCGATGCCCCCTGCTCCTGTGCCACCTGGTACTCCAGCTCCTCCAGGACCTGCCACT
ATGATGCCAGATGGAACCCTTGGATTGACCCCACCAACAACTGAACGTTTTGGCCAAGCTGCAACAATGG
AAGGAATTGGAGCAATTGGTGGAACTCCTCCTGCATTCAACCGTCCAGCTCCGGGAGCTGAATTTGCTCC
AAATAAACGCCGCCGATATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252518
Insert Size 1422 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252518.1, NP_001239447.1
RefSeq Size 2465 bp
RefSeq ORF 1422 bp
Locus ID 53610
UniProt ID Q99K48
Gene Summary DNA- and RNA binding protein, involved in several nuclear processes. Binds the conventional octamer sequence in double-stranded DNA. Also binds single-stranded DNA and RNA at a site independent of the duplex site. Involved in pre-mRNA splicing, probably as a heterodimer with SFPQ. Interacts with U5 snRNA, probably by binding to a purine-rich sequence located on the 3' side of U5 snRNA stem 1b. Together with PSPC1, required for the formation of nuclear paraspeckles. The SFPQ-NONO heteromer associated with MATR3 may play a role in nuclear retention of defective RNAs. The SFPQ-NONO heteromer may be involved in DNA unwinding by modulating the function of topoisomerase I/TOP1. The SFPQ-NONO heteromer may be involved in DNA non-homologous end joining (NHEJ) required for double-strand break repair and V(D)J recombination and may stabilize paired DNA ends. In vitro, the complex strongly stimulates DNA end joining, binds directly to the DNA substrates and cooperates with the Ku70/G22P1-Ku80/XRCC5 (Ku) dimer to establish a functional preligation complex. NONO is involved in transcriptional regulation. The SFPQ-NONO-NR5A1 complex binds to the CYP17 promoter and regulates basal and cAMP-dependent transcriptional activity. NONO binds to an enhancer element in long terminal repeats of endogenous intracisternal A particles (IAPs) and activates transcription. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer. Important for the functional organization of GABAergic synapses. Plays a specific and important role in the regulation of synaptic RNAs and GPHN/gephyrin scaffold structure, through the regulation of GABRA2 transcript (PubMed:26571461).Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...