Rxra (NM_001290481) Mouse Untagged Clone

CAT#: MC227709

Rxra (untagged) - Mouse retinoid X receptor alpha (Rxra), transcript variant 2



  "NM_001290481" in other vectors (1)

CNY 4,280.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9530071D11Rik; Nr2b1; RXRalpha1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227709 representing NM_001290481
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGTCCCCTCGCTGCACCCCTCCTTGGGTCCGGGAATCGGCTCTCCACTGGGCTCGCCTGGGCAGC
TGCACTCTCCTATCAGCACCCTGAGCTCCCCCATCAATGGCATGGGTCCGCCCTTCTCTGTCATCAGCTC
CCCCATGGGCCCGCACTCCATGTCGGTACCCACCACACCCACATTGGGCTTCGGGACTGGTAGCCCCCAG
CTCAATTCACCCATGAACCCTGTGAGCAGCACTGAGGATATCAAGCCGCCACTAGGCCTCAATGGCGTCC
TCAAGGTTCCTGCCCATCCCTCAGGAAATATGGCCTCCTTCACCAAGCACATCTGTGCTATCTGTGGGGA
CCGCTCCTCAGGCAAACACTATGGGGTATACAGTTGTGAGGGCTGCAAGGGCTTCTTCAAGAGGACAGTA
CGCAAAGACCTGACCTACACCTGCCGAGACAACAAGGACTGCCTGATCGACAAGAGACAGCGGAACCGGT
GTCAGTACTGCCGCTACCAGAAGTGCCTGGCCATGGGCATGAAGCGGGAAGCTGTGCAGGAGGAGCGGCA
GCGGGGCAAGGACCGGAATGAGAACGAGGTGGAGTCCACCAGCAGTGCCAACGAGGACATGCCTGTAGAG
AAGATTCTGGAAGCCGAGCTTGCTGTCGAGCCCAAGACTGAGACATACGTGGAGGCAAACATGGGGCTGA
ACCCCAGCTCACCAAATGACCCTGTTACCAACATCTGTCAAGCAGCAGACAAGCAGCTCTTCACTCTTGT
GGAGTGGGCCAAGAGGATCCCACACTTTTCTGAGCTGCCCCTAGACGACCAGGTCATCCTGCTACGGGCA
GGCTGGAACGAGCTGCTGATCGCCTCCTTCTCCCACCGCTCCATAGCTGTGAAAGATGGGATTCTCCTGG
CCACCGGCCTGCACGTACACCGGAACAGCGCTCACAGTGCTGGGGTGGGCGCCATCTTTGACAGGGTGCT
AACAGAGCTGGTGTCTAAGATGCGTGACATGCAGATGGACAAGACGGAGCTGGGCTGCCTGCGAGCCATT
GTCCTGTTCAACCCTGACTCTAAGGGGCTCTCAAACCCTGCTGAGGTGGAGGCGTTGAGGGAGAAGGTGT
ATGCGTCACTAGAAGCGTACTGCAAACACAAGTACCCTGAGCAGCCGGGCAGGTTTGCCAAGCTGCTGCT
CCGCCTGCCTGCACTGCGTTCCATCGGGCTCAAGTGCCTGGAGCACCTGTTCTTCTTCAAGCTCATCGGG
GACACGCCCATCGACACCTTCCTCATGGAGATGCTGGAGGCACCACATCAAGCCACCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290481
Insert Size 1320 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290481.1, NP_001277410.1
RefSeq Size 5088 bp
RefSeq ORF 1320 bp
Locus ID 20181
Gene Summary Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and it thus differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Both variants 2 and 3 encode isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...