Arrb2 (NM_001271360) Mouse Untagged Clone
CAT#: MC227546
Arrb2 (untagged) - Mouse arrestin, beta 2 (Arrb2), transcript variant 4
CN¥ 3,900.00
货期*
3周
规格
Product images

经常一起买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI326910; Arr3; AW122872 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC227546 representing NM_001271360
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAGAAAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACCGTGTACTTGG GCAAGCGCGACTTTGTAGATCACCTGGACAAAGTGGACCCTGTGGATGGCGTGGTGCTTGTGGATCCTGA CTACTTGAAGGACCGGAAAGTGTTCGTGACCCTCACCTGTGCCTTCCGCTATGGCCGAGAAGACCTGGAT GTACTGGGCCTGTCTTTCCGCAAAGATCTGTTCATCGCCACCTACCAGGCCTTCCCCCCCATGCCCAACC CACCTCGGCCCCCCACCCGCCTACAGGACCGACTGCTGAAGAAGTTGGGCCAACACGCCCACCCCTTCTT TTTCACGATACCCCAAAATTTGCCTTGCTCCGTCACACTGCAGCCAGGACCAGAGGACACAGGGAAGGCT TGTGGAGTAGACTTTGAGATTCGAGCTTTCTGTGCCAAATCAATAGAAGAAAAAAGTCACAAGAGGAACT CTGTGCGGCTTATCATCAGAAAGGTACAGTTTGCTCCTGAGACACCCGGTCCCCAGCCCTCAGCTGAAAC CACACGCCACTTCCTCATGTCTGACCGGAGGTCCCTCCACCTAGAGGCTTCCCTGGACAAAGAGCTGTAC TACCACGGGGAGCCCCTTAATGTCAACGTCCATGTCACCAACAATTCTGCCAAGACCGTCAAGAAGATCA GAGTGTCTGTGAGACAGTACGCCGACATTTGCCTCTTCAGCACCGCGCAGTACAAGTGTCCCGTGGCTCA GCTAGAACAAGATGACCAGGTGTCTCCTAGTTCCACGTTCTGCAAGGTGTACACCATCACCCCGCTGCTC AGTGACAACCGAGAGAAGCGTGGCCTTGCCTTGGATGGGCAGCTCAAACATGAAGACACCAACCTGGCTT CCAGCACCATTGTGAAGGAGGGAGCCAACAAGGAGGTGCTGGGGATCCTGGTATCCTACAGGGTCAAGGT GAAGCTGGTGGTGTCTCGAGGCGGAGATGTCTCCGTGGAGCTACCCTTCGTCCTAATGCACCCCAAGCCC CATGACCACATCACCCTTCCCAGACCCCAGTCAGCCCCCCGGGAAACAGACGTGCCTGTGGATACCAACC TCATCGAATTCGATACCAACTATGCCACAGACGATGACATCGTGTTTGAGGACTTTGCCCGGCTCCGGCT GAAGGGAATGAAGGATGATGACTGTGATGACCAGTTTTGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271360 |
Insert Size | 1233 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271360.1, NP_001258289.1 |
RefSeq Size | 1475 bp |
RefSeq ORF | 1233 bp |
Locus ID | 216869 |
UniProt ID | Q91YI4 |
Gene Summary | Functions in regulating agonist-mediated G-protein coupled receptor (GPCR) signaling by mediating both receptor desensitization and resensitization processes. During homologous desensitization, beta-arrestins bind to the GPRK-phosphorylated receptor and sterically preclude its coupling to the cognate G-protein; the binding appears to require additional receptor determinants exposed only in the active receptor conformation. The beta-arrestins target many receptors for internalization by acting as endocytic adapters (CLASPs, clathrin-associated sorting proteins) and recruiting the GPRCs to the adapter protein 2 complex 2 (AP-2) in clathrin-coated pits (CCPs). However, the extent of beta-arrestin involvement appears to vary significantly depending on the receptor, agonist and cell type. Internalized arrestin-receptor complexes traffic to intracellular endosomes, where they remain uncoupled from G-proteins. Two different modes of arrestin-mediated internalization occur. Class A receptors, like ADRB2, OPRM1, ENDRA, D1AR and ADRA1B dissociate from beta-arrestin at or near the plasma membrane and undergo rapid recycling. Class B receptors, like AVPR2, AGTR1, NTSR1, TRHR and TACR1 internalize as a complex with arrestin and traffic with it to endosomal vesicles, presumably as desensitized receptors, for extended periods of time. Receptor resensitization then requires that receptor-bound arrestin is removed so that the receptor can be dephosphorylated and returned to the plasma membrane. Mediates endocytosis of CCR7 following ligation of CCL19 but not CCL21. Involved in internalization of P2RY1, P2RY4, P2RY6 and P2RY11 and ATP-stimulated internalization of P2RY2. Involved in phosphorylation-dependent internalization of OPRD1 and subsequent recycling or degradation. Involved in ubiquitination of IGF1R. Beta-arrestins function as multivalent adapter proteins that can switch the GPCR from a G-protein signaling mode that transmits short-lived signals from the plasma membrane via small molecule second messengers and ion channels to a beta-arrestin signaling mode that transmits a distinct set of signals that are initiated as the receptor internalizes and transits the intracellular compartment. Acts as signaling scaffold for MAPK pathways such as MAPK1/3 (ERK1/2) and MAPK10 (JNK3). ERK1/2 and JNK3 activated by the beta-arrestin scaffold are largely excluded from the nucleus and confined to cytoplasmic locations such as endocytic vesicles, also called beta-arrestin signalosomes. Acts as signaling scaffold for the AKT1 pathway. GPCRs for which the beta-arrestin-mediated signaling relies on both ARRB1 and ARRB2 (codependent regulation) include ADRB2, F2RL1 and PTH1R. For some GPCRs the beta-arrestin-mediated signaling relies on either ARRB1 or ARRB2 and is inhibited by the other respective beta-arrestin form (reciprocal regulation). Increases ERK1/2 signaling in AGTR1- and AVPR2-mediated activation (reciprocal regulation). Involved in CCR7-mediated ERK1/2 signaling involving ligand CCL19. Is involved in type-1A angiotensin II receptor/AGTR1-mediated ERK activity. Is involved in type-1A angiotensin II receptor/AGTR1-mediated MAPK10 activity. Is involved in dopamine-stimulated AKT1 activity in the striatum by disrupting the association of AKT1 with its negative regulator PP2A. Involved in AGTR1-mediated chemotaxis. Appears to function as signaling scaffold involved in regulation of MIP-1-beta-stimulated CCR5-dependent chemotaxis. Involved in attenuation of NF-kappa-B-dependent transcription in response to GPCR or cytokine stimulation by interacting with and stabilizing CHUK. Suppresses UV-induced NF-kappa-B-dependent activation by interacting with CHUK. The function is promoted by stimulation of ADRB2 and dephosphorylation of ARRB2. Involved in IL8-mediated granule release in neutrophils (By similarity). Involved in p53/TP53-mediated apoptosis by regulating MDM2 and reducing the MDM2-mediated degradation of p53/TP53. May serve as nuclear messenger for GPCRs. Upon stimulation of OR1D2, may be invol Transcript Variant: This variant (4) uses an alternate in-frame splice site in the coding region and differs in the 3' UTR, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Variants 3 and 4 encode the same isoform (b). Sequence Note: The RefSeq transcript was derived from the reference genome assembly. The genomic coordinates were determined from alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR229757 | Arrb2 (myc-DDK-tagged) - Mouse arrestin, beta 2 (Arrb2), transcript variant 4 |
CN¥ 3,656.00 |
Customer
Reviews
Loading...