Oprk1 (NM_001204371) Mouse Untagged Clone

CAT#: MC227386

Oprk1 (untagged) - Mouse opioid receptor, kappa 1 (Oprk1), transcript variant 1



  "NM_001204371" in other vectors (1)

CNY 3,610.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms K-OR-1; KOR; KOR-1; MSL-1; Op; Oprk2; R2; R21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209123 representing NM_011011
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCCCCCATTCAGATCTTCCGAGGAGATCCAGGCCCTACCTGCTCTCCCAGTGCTTGCCTTCTCC
CCAACAGCAGCTCTTGGTTCCCCAACTGGGCAGAATCCGACAGTAATGGCAGTGTGGGCTCAGAGGATCA
GCAGCTGGAGTCCGCGCACATCTCTCCGGCCATCCCTGTTATCATCACCGCTGTCTACTCTGTGGTATTT
GTGGTGGGCTTAGTGGGCAATTCTCTGGTCATGTTTGTCATCATCCGATACACGAAGATGAAGACCGCAA
CCAACATCTACATATTTAACCTGGCTTTGGCAGATGCTTTGGTTACTACCACTATGCCCTTTCAGAGTGC
TGTCTACTTGATGAATTCTTGGCCTTTTGGAGATGTGCTATGCAAGATTGTCATTTCCATTGACTACTAC
AACATGTTTACCAGCATATTCACCTTGACCATGATGAGTGTGGACCGCTACATTGCTGTGTGCCACCCTG
TGAAAGCTTTGGACTTCCGAACACCTTTGAAAGCAAAGATCATCAACATCTGCATTTGGCTCCTGGCATC
ATCTGTTGGTATATCAGCGATAGTCCTTGGAGGCACCAAAGTCAGGGAAGATGTGGATGTCATTGAATGC
TCCTTGCAGTTTCCTGATGATGAATATTCCTGGTGGGATCTCTTCATGAAGATCTGTGTCTTCGTCTTTG
CCTTTGTGATCCCAGTCCTCATCATCATTGTCTGCTACACCCTGATGATCCTGCGCCTGAAGAGTGTCCG
GCTCCTGTCTGGCTCCCGAGAGAAGGACCGAAATCTCCGCCGCATCACCAAGCTGGTGCTGGTAGTAGTT
GCAGTCTTCATCATCTGTTGGACCCCCATTCACATCTTTATCCTGGTGGAGGCTCTGGGAAGCACCTCCC
ACAGCACAGCTGCCCTCTCCAGCTATTATTTCTGTATTGCCTTGGGTTATACCAACAGCAGCCTGAATCC
TGTTCTCTATGCCTTTCTGGATGAAAACTTCAAGCGGTGTTTTAGGGACTTCTGCTTCCCTATTAAGATG
CGAATGGAGCGCCAGAGCACCAATAGAGTTAGAAACACAGTTCAGGATCCTGCTTCCATGAGAGATGTGG
GAGGGATGAATAAGCCAGTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001204371
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204371.1, NP_001191300.1
RefSeq Size 4707 bp
RefSeq ORF 1143 bp
Locus ID 18387
UniProt ID P33534
Gene Summary This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]
Transcript Variant: This variant (1) represents the longer transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon, while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UGA termination codon. This RefSeq represents the shorter isoform (1). Variants 1 and 2 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...