Mapk1 (NM_001038663) Mouse Untagged Clone

CAT#: MC227260

Mapk1 (untagged) - Mouse mitogen-activated protein kinase 1 (Mapk1), transcript variant 2



  "NM_001038663" in other vectors (1)

CN¥ 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Anti-ERK/MAPK Antibody
    • 100 ul

CN¥ 5,643.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9030612K14Rik; AA407128; AU018647; C78273; ERK; Erk2; MAPK2; p41mapk; p42mapk; Prkm1; PRKM2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227260 representing NM_001038663
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGCGGCGGCGGCGGGCCCGGAGATGGTCCGCGGGCAGGTGTTCGACGTAGGGCCGCGCTACA
CCAACCTCTCGTACATCGGAGAAGGCGCCTACGGCATGGTTTGCTCTGCTTATGATAATCTCAACAAAGT
TCGAGTTGCTATCAAGAAAATCAGTCCTTTTGAGCACCAGACCTACTGTCAAAGAACCCTAAGAGAGATA
AAAATCTTACTGCGCTTCAGACATGAGAACATCATTGGCATCAATGACATCATCCGGGCACCAACCATTG
AGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAGACGGACCTTTACAAGCTCTTGAAGACACA
GCACCTCAGCAATGACCACATCTGCTATTTTCTTTATCAGATCCTGAGAGGGCTAAAGTATATCCATTCA
GCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTCCTGCTGAACACCACTTGTGATCTCAAGATCT
GTGACTTTGGCCTTGCCCGTGTTGCAGATCCAGATCATGATCACACAGGGTTCTTGACAGAGTACGTAGC
CACACGTTGGTACAGAGCTCCAGAAATTATGTTGAATTCCAAGGGTTATACCAAGTCCATTGATATTTGG
TCTGTGGGCTGCATCCTGGCAGAGATGCTATCCAACAGGCCTATCTTCCCAGGAAAGCATTACCTTGACC
AGCTGAATCACATCCTGGGTATTCTTGGATCTCCATCACAGGAAGATCTGAATTGTATAATAAATTTAAA
AGCTAGAAACTATTTGCTTTCTCTCCCGCACAAAAATAAGGTGCCATGGAACAGGTTGTTCCCAAATGCT
GACTCCAAAGCTCTGGATTTACTGGATAAAATGTTGACATTTAACCCTCACAAGAGGATTGAAGTTGAAC
AGGCTCTGGCCCACCCATACCTGGAGCAGTATTATGACCCAAGTGATGAGCCCATTGCTGAAGCGCCATT
CAAGTTTGACATGGAGTTGGACGACTTACCTAAGGAGAAGCTCAAAGAACTCATTTTTGAAGAGACTGCT
AGATTCCAGCCAGGATACAGATCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001038663
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001038663.1, NP_001033752.1
RefSeq Size 1932 bp
RefSeq ORF 1077 bp
Locus ID 26413
UniProt ID P63085
Gene Summary Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK1/ERK2 and MAPK3/ERK1 are the 2 MAPKs which play an important role in the MAPK/ERK cascade. They participate also in a signaling cascade initiated by activated KIT and KITLG/SCF. Depending on the cellular context, the MAPK/ERK cascade mediates diverse biological functions such as cell growth, adhesion, survival and differentiation through the regulation of transcription, translation, cytoskeletal rearrangements. The MAPK/ERK cascade plays also a role in initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors. About 160 substrates have already been discovered for ERKs. Many of these substrates are localized in the nucleus, and seem to participate in the regulation of transcription upon stimulation. However, other substrates are found in the cytosol as well as in other cellular organelles, and those are responsible for processes such as translation, mitosis and apoptosis. Moreover, the MAPK/ERK cascade is also involved in the regulation of the endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC); as well as in the fragmentation of the Golgi apparatus during mitosis. The substrates include transcription factors (such as ATF2, BCL6, ELK1, ERF, FOS, HSF4 or SPZ1), cytoskeletal elements (such as CANX, CTTN, GJA1, MAP2, MAPT, PXN, SORBS3 or STMN1), regulators of apoptosis (such as BAD, BTG2, CASP9, DAPK1, IER3, MCL1 or PPARG), regulators of translation (such as EIF4EBP1) and a variety of other signaling-related molecules (like ARHGEF2, DCC, FRS2 or GRB10). Protein kinases (such as RAF1, RPS6KA1/RSK1, RPS6KA3/RSK2, RPS6KA2/RSK3, RPS6KA6/RSK4, SYK, MKNK1/MNK1, MKNK2/MNK2, RPS6KA5/MSK1, RPS6KA4/MSK2, MAPKAPK3 or MAPKAPK5) and phosphatases (such as DUSP1, DUSP4, DUSP6 or DUSP16) are other substrates which enable the propagation the MAPK/ERK signal to additional cytosolic and nuclear targets, thereby extending the specificity of the cascade. Mediates phosphorylation of TPR in respons to EGF stimulation. May play a role in the spindle assembly checkpoint. Phosphorylates PML and promotes its interaction with PIN1, leading to PML degradation. Phosphorylates CDK2AP2 (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...