Rassf1 (NM_001243748) Mouse Untagged Clone

CAT#: MC227130

Rassf1 (untagged) - Mouse Ras association (RalGDS/AF-6) domain family member 1 (Rassf1), transcript variant 1



  "NM_001243748" in other vectors (1)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 123F2; AA536941; AU044980; NORE2A; Rassf1A; Rassf1B; Rassf1C; RDA32; REH3P21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227130 representing NM_001243748
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGCGGAGCCAGAACTCATTGAACTACGCGAGCTGGCACCGTCCGGGCGCATCGGTCCAGGCCGTA
CCCGGCTGGAGCGTGCCAACGCTCTGCGCATCGCCCCGGGTACAACACGCAATCCGTCACAGCAGCACGT
CCCGGGTCGTGGCCACCGTTTCCAGCCTGCAGGGCCCACCACGCACACGTGGTGCGACCTCTGTGGAGAC
TTCATCTGGGGCGTCGTGCGCAAGGGCCTACAGTGCGCGCACTGCAAGTTCACCTGCCATTACCGTTGTC
GCGCGCTCGTCTGCTTGGACTGCTGCGGGCCCCGAGACCTGGGCTGGGACTCTGCACTAGAGCGGGATAC
GAACGTGGATGAGGCTGTAGAGCGGGAGACACCCGATCTTTCTCAAGCTGAGACTGAGCAGAAAATCAAG
GACTACAATGGCCAGATCAACAGCAACCTCTTCATGAGCCTGAATAAGGATGGCTCCTACACAGGCTTCA
TCAAGGTTCAGCTGAAACTAGTGCGTCCTGTTTCAGTGCCTTCCAGCAAGAAACCACCTTCCTTACAGGA
CGCCCGGAGAGGTACGGGGCGGAGCACAGCCGTGAAGCGCCGCACCTCTTTTTACTTGCCTAAGGATGCT
ATTAAGCATCTGCATGTTCTATCACGAACACGGGCACGTGAGGTCATTGAGGCCCTGCTTCGAAAATTCA
TGGTCGTAGATGATCCTCGCAAGTTTGCACTCTTTGAGCGAACTGAACGGCATGGCCAAGTATACCTCCG
GAAGCTGTCGGATGACGAGCAGCCCTTGAAGCTGCGGCTTCTTGCAGGGCCCAGTGAAAAAGCCCTGAGC
TTTGTCCTGAAGGAAAATGACTCGGGAGAGGTGAACTGGGATGCCTTCAGCATGCCTGAACTGCACAATT
TCCTACGAATCCTGCAGCGGGAAGAAGAGGAACACCTTCGCCAGATCCTGCAGAAGTATTCTCGTTGTCG
CCAGAAGATCCAGGAGGCTCTGCACGCCTGTCCTTTGGGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001243748
Insert Size 1023 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243748.1, NP_001230677.1
RefSeq Size 1787 bp
RefSeq ORF 1023 bp
Locus ID 56289
UniProt ID Q99MK9
Gene Summary Potential tumor suppressor. Required for death receptor-dependent apoptosis. Mediates activation of Mediates activation of STK3/MST2 and STK4/MST1 during Fas-induced apoptosis by preventing their dephosphorylation. When associated with MOAP1, promotes BAX conformational change and translocation to mitochondrial membranes in response to TNF and TNFSF10 stimulation. Isoform A interacts with CDC20, an activator of the anaphase-promoting complex, APC, resulting in the inhibition of APC activity and mitotic progression. Inhibits proliferation by negatively regulating cell cycle progression at the level of G1/S-phase transition by regulating accumulation of cyclin D1 protein. Isoform C has been shown not to perform these roles, no function has been identified for this isoform. Isoform A disrupts interactions among MDM2, DAXX and USP7, thus contributing to the efficient activation of TP53 by promoting MDM2 self-ubiquitination in cell-cycle checkpoint control in response to DNA damage (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...