Lgals8 (NM_001291055) Mouse Untagged Clone

CAT#: MC227039

Lgals8 (untagged) - Mouse lectin, galactose binding, soluble 8 (Lgals8), transcript variant 3



  "NM_001291055" in other vectors (1)

CNY 3,140.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1200015E08Rik; AI326142; D13Ertd524e; Lgals-8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227039 representing NM_001291055
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGTCCTTAAATAACCTACAAAATATCATCTATAACCCGATAATCCCCTATGTTGGCACCATTACTG
AGCAATTGAAGCCTGGCTCTCTGATTGTAATCCGTGGGCATGTCCCTAAAGATTCAGAAAGATTCCAGGT
TGACTTTCAGCTGGGCAACAGCCTGAAGCCAAGAGCAGACGTGGCCTTCCACTTTAACCCTCGGTTCAAA
AGGTCTAGCTGCATTGTTTGTAACACACTGACACAGGAGAAGTGGGGCTGGGAGGAGATCACCTACGACA
TGCCCTTCAGAAAAGAAAAGTCCTTTGAGATCGTGTTCATGGTGCTCAAGAACAAATTCCAGGTGGCTGT
GAACGGAAGGCATGTTCTGCTGTACGCCCACAGGATCAGCCCGGAGCAGATCGACACAGTGGGCATCTAC
GGCAAAGTGAACATCCACTCCATCGGGTTCAGATTCAGCTCGGCAAGTGCCCTTCCACACACACTGGGGG
ATTTACAGAGTATGGAAACATCTGCTCTGGGACTGACACAGATAAACAGAGAGAATATACAAAAGCCAGG
CAAGCTCCAGCTGAGCCTGCCATTTGAAGCAAGGTTGAATGCCTCCATGGGTCCTGGACGAACCGTTGTC
ATTAAAGGGGAAGTGAACACCAATGCCCGAAGCTTTAATGTTGACCTAGTGGCAGGAAAAACAAGGGATA
TCGCTCTGCACTTGAACCCACGCCTCAATGTGAAAGCATTTGTAAGAAATTCCTTTCTTCAGGATGCCTG
GGGAGAAGAGGAGAGAAATATTACCTGCTTCCCATTTAGTTCTGGGATGTACTTTGAGATGATAATCTAC
TGTGATGTCCGGGAATTCAAGGTTGCTATAAATGGTGTGCACAGCCTGGAGTACAAACACAGATTTAAAG
ACCTAAGCAGTATTGATACACTATCAGTCGATGGTGATATCCGTTTGCTGGATGTAAGGAGCTGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291055
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291055.1, NP_001277984.1
RefSeq Size 2522 bp
RefSeq ORF 978 bp
Locus ID 56048
Gene Summary Beta-galactoside-binding lectin that acts as a sensor of membrane damage caused by infection and restricts the proliferation of infecting pathogens by targeting them for autophagy. Detects membrane rupture by binding beta-galactoside ligands located on the lumenal side of the endosome membrane; these ligands becoming exposed to the cytoplasm following rupture. Restricts infection by initiating autophagy via interaction with CALCOCO2/NDP52. Required to restrict infection of bacterial invasion such as S.typhimurium. Also required to restrict infection of Picornaviridae viruses. Has a marked preference for 3'-O-sialylated and 3'-O-sulfated glycans.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) encodes the longest isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...