Deaf1 (NM_001282072) Mouse Untagged Clone

CAT#: MC226956

Deaf1 (untagged) - Mouse deformed epidermal autoregulatory factor 1 (Drosophila) (Deaf1), transcript variant 2



  "NM_001282072" in other vectors (1)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AU042387; C230009B13Rik; NUDR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226956 representing NM_001282072
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGAGGCTGTGTGCTTGCCTGGCAGCAGTGCTCTTCATGGATTTCTTCAGAAAATGTCTTCTCTACC
ATTCTGAGGGCTCCTGTGGACGTCTGCTCTCTGCAGTAAGTGGCCCTGTCAGGCTCTTCGTCCCTTATAA
AAGGCGCAAGAAAGAGAATGAGCTGCCCACAACTCCAGTGAAGAAGGATTCCCCCAAGAACATCACCCTG
CTTCCTGCCACGGCGGCCACCACCTTCACTGTGACACCCTCAGGACAGATCACTACCTCTGGAGCACTGA
CCTTTGACAGAGCATCCACTGTAGAGGCCACTGCTGTCATCTCTGAGAGCCCAGCCCAAGGTGATGTCTT
TGCAGGAGCCACAGTGCAAGAGGCAGGTGTGCAGCCTCCCTGCAGGGTTGGCCACCCTGAACCCCACTAC
CCTGGCTATCAGGACAGCTGCCAGATTGCCCCGTTTCCAGAAGCTGCATTGCCAACATCACACCCCAAAA
TTGTCCTGACATCGCTGCCCGCATTGGCCGTGCCACCGTCCACCCCCACCAAAGCTGTCTCTCCCACCGT
GGTCAGTGGGCTGGAGATGTCAGAACATCGGAGCTGGCTGTACCTGGAAGAGATGGTCAACTCCCTACTC
AACACAGCTCAGCAGCTGAAGACGCTGTTTGAACAAGCCAAGCAGGCGAGCTCTTGCAGGGAAGCTGCTG
TGACCCAGGCGAGAATGCAGGTTGATACAGAGAGGAAAGAGCAGTCATGTGTCAACTGCGGCCGGGAGGC
CATGAGTGAGTGTACCGGCTGCCACAAGGTTAACTACTGCTCTACGTTCTGCCAGCGCAAGGACTGGAAA
GACCATCAGCATGTGTGTGGCCAGTCAGCGTCTGTCACTGTCCAGGCTGATGACGTCCATGTTGAAGAAA
GTGTGATAGAAAAAGTTGCTGTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001282072
Insert Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282072.1, NP_001269001.1
RefSeq Size 2368 bp
RefSeq ORF 936 bp
Locus ID 54006
Gene Summary Transcription factor that binds to sequence with multiple copies of 5'-TTC[CG]G-3' present in its own promoter and that of the HNRPA2B1 gene. Down-regulates transcription of these genes. Binds to the retinoic acid response element (RARE) 5'-AGGGTTCACCGAAAGTTCA-3'. Activates the proenkephalin gene independently of promoter binding, probably through protein-protein interaction (By similarity). Regulates epithelial cell proliferation and side-branching in the mammary gland. Required for neural tube closure and skeletal patterning. Controls the expression of peripheral tissue antigens in pancreatic lymph nodes. Isoform 1 displays greater transcriptional activity than isoform 2. Isoform 2 may inhibit transcriptional activity of isoform 1 by interacting with it and retaining it in the cytoplasm. Transcriptional activator of EIF4G3 (By similarity). May also involved in behavior (PubMed:24726472).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate 5' structure, and thus differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at an alternate AUG and result in an isoform (c) with a shorter and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...