Fcer2a (NM_001253745) Mouse Untagged Clone

CAT#: MC226945

Fcer2a (untagged) - Mouse Fc receptor, IgE, low affinity II, alpha polypeptide (Fcer2a), transcript variant 5



  "NM_001253745" in other vectors (1)

CN¥ 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


CD23 Rabbit mAb
    • 100 ul

CN¥ 7,740.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CD23; Fce2; Fcer2; Ly-42
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226945 representing NM_001253745
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATTCTCAAAACCAGGGATACTGGGAACCTCCTAGAAAGCGTTGCTGCTGTGCAAGACGTGGGACAC
AGCTCATGTTGGTGGGGCTGCTGAGCACAGCAATGTGGGCTGGCCTGCTGGCCCTGCTTCTTCTGTGGCA
CTGGGAAACGGAGAAGAATCTAAAACAGCTGGGAGACACTGCAATTCAGAATGTTGTTCAGATGTCACAA
AACTTGCAAGAACTCCAAGCTGAACAGAAGCAAATGAAAGCTCAGGACTCTCGGCTCTCCCAGAACCTGA
CCGGACTCCAGGAGGATCTAAGGAACGCCCAATCCCAGAACTCAAAACTCTCCCAGAACCTGAACAGACT
CCAAGACGATCTAGTCAACATCAAATCCCTGGGCTTGAATGAGAAGCGCACAGCCTCCGATTCTCTAGAG
AAACTCCAGGAAGAGGTGGCAAAGCTGTGGATAGAGATACTGATTTCAAAGGGAACTGCATGCAACATAT
GTCCCAAGAACTGGCTCCATTTCCAACAGAAGTGCTACTATTTTGGCAAGGGCTCCAAGCAGTGGATCCA
GGCCAGGTTCGCCTGCAGTGACCTGCAAGGGCGACTAGTCAGCATCCACAGCCAAAAGGAACAGGACTTC
CTGATGCAACACATCAACAAGAAGGATTCCTGGATTGGCCTCCAGGATCTCAATATGGAGGGAGAGTTTG
TATGGTCGGACGGGAGCCCTGTGGGTTATAGCAACTGGAATCCAGGGGAGCCCAATAACGGGGGCCAGGG
TGAGGACTGTGTGATGATGCGGGGATCCGGCCAGTGGAACGACGCCTTCTGCCGCAGCTACTTGGATGCA
TGGGTGTGTGAGCAGCTGGCAACATGTGAGATATCTGCCCCCTTAGCCTCTGTGACTCCAACAAGGCCCA
CCCCAAAAAGTGAACCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253745
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253745.1, NP_001240674.1
RefSeq Size 2037 bp
RefSeq ORF 930 bp
Locus ID 14128
UniProt ID P20693
Gene Summary Low-affinity receptor for immunoglobulin E (IgE) and CR2/CD21. Has essential roles in the regulation of IgE production and in the differentiation of B-cells (it is a B-cell-specific antigen).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) has a different 5' end with an alternate start codon and lacks an alternate exon in the coding region, compared to variant 1. The resulting protein (isoform E) has a shorter and distinct N-terminus when it is compared to isoform A. Although variants 5 and 6 encode a protein of the same length (309 aa), the sequence of the two proteins (isoform E and isoform F) are different. Isoform E has also been called Fc epsilon receptor II subtype b variant b delta 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...