Ccnd3 (NM_001081636) Mouse Untagged Clone

CAT#: MC226838

Ccnd3 (untagged) - Mouse cyclin D3 (Ccnd3), transcript variant 3



  "NM_001081636" in other vectors (1)

CNY 2,850.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9230106B05Rik; AA682053; AL024085; AW146355; C78795
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226838 representing NM_001081636
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCTGCTGTGTTGCGAGGGCACCCGGCACGCGCCCCGGGCCGGGCCCGACCCGCGGCTGCTTGGGG
ACCAGCGTGTCCTGCAGAGTTTACTCCGCCTGGAGGAGCGCTACGTGCCGCGAGCCTCCTACTTCCAGTG
CGTGCAAAAGGAGATCAAGCCGCACATGCGGAAGATGCTGGCATACTGGATGCTGGAGGTGTGTGAGGAG
CAGCGCTGCGAGGAGGATGTCTTCCCTCTGGCTATGAACTACCTGGATCGCTACCTGTCCTGCGTCCCCA
CCCGAAAGGCGCAATTGCAGCTTCTAGGTACCGTCTGCCTGTTGCTGGCCTCCAAGCTGCGCGAAACCAC
GCCCCTGACTATTGAGAAGCTTTGCATCTATACGGACCAGGCTGTGGCTCCATGGCAGTTGCGGGAGTGG
GAGGTGCTGGTCCTGGGGAAGCTCAAGTGGGACCTGGCTGCCGTGATTGCGCACGACTTCCTGGCCTTGA
TTCTGCACCGCCTGTCTCTGCCCAGTGACCGGCAGGCTTTGGTCAAAAAGCATGCCCAGACCTTTTTGGC
CCTCTGTGCTACAGATTACACCTTTGCGATGTATCCTCCATCCATGATCGCCACAGGCAGCATTGGGGCA
GCCGTGCTAGGCCTAGGCGCCTGCTCTATGTCTGCGGATGAGCTCACAGAGTTGCTGGCCGGGATCACAG
GCACTGAAGTGGACTGCCTGCGAGCCTGCCAGGAACAGATCGAAGCTGCCCTCAGGGAGAGCCTCAGGGA
AGCTGCTCAGACAGCCCCCAGCCCAGTGCCCAAAGCCCCCCGGGGCTCTAGCAGCCAGGGGCCCAGTCAG
ACCAGCACTCCCACAGATGTCACAGCCATTCACCTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001081636
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001081636.1, NP_001075105.1
RefSeq Size 2131 bp
RefSeq ORF 879 bp
Locus ID 12445
UniProt ID P30282
Gene Summary Regulatory component of the cyclin D3-CDK4 (DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family including RB1 and regulates the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complex and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also substrate for SMAD3, phosphorylating SMAD3 in a cell-cycle-dependent manner and repressing its transcriptional activity. Component of the ternary complex, cyclin D3/CDK4/CDKN1B, required for nuclear translocation and activity of the cyclin D-CDK4 complex.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) represents the longest transcript. All three variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...