Gjb1 (NM_001302496) Mouse Untagged Clone

CAT#: MC226777

Gjb1 (untagged) - Mouse gap junction protein, beta 1 (Gjb1), transcript variant 2



  "NM_001302496" in other vectors (1)

CN¥ 2,850.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
GJB1 Antibody - middle region
    • 50 ug

CN¥ 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cnx32; connex; connexin-32; Cx32; Cxng
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226777 representing NM_001302496
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTGGACAGGTCTATACACCTTGCTCAGTGGCGTGAATCGGCACTCTACAGCCATTGGCCGAGTAT
GGCTGTCTGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCTGAGAGCGTGTGGGGGGATGA
GAAGTCCTCTTTCATCTGTAACACCCTCCAGCCGGGCTGCAACAGCGTCTGCTATGACCATTTTTTCCCC
ATCTCCCACGTGCGCCTATGGTCCCTGCAGCTTATCTTGGTTTCCACCCCAGCTCTCCTCGTGGCAATGC
ACGTAGCTCACCAACAGCACATAGAAAAGAAAATGCTACGGCTTGAGGGGCATGGGGACCCCCTTCACCT
GGAAGAGGTAAAGAGACACAAGGTGCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGTGTGGTG
TTCCGGCTGCTGTTCGAGGCTGTCTTCATGTATGTCTTCTATCTGCTCTACCCCGGCTATGCCATGGTGC
GGCTGGTCAAGTGTGAAGCCTTCCCCTGCCCCAACACAGTGGACTGCTTCGTGTCCCGCCCCACCGAGAA
AACCGTCTTCACTGTCTTTATGCTCGCAGCCTCCGGCATCTGCATTATCCTCAACGTGGCGGAGGTGGTG
TACCTCATCATCCGGGCCTGTGCCCGCCGTGCTCAGCGCCGCTCCAATCCGCCCTCCCGCAAGGGCTCGG
GCTTCGGCCACCGCCTCTCACCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGCGAGCAGGATGG
CTCTCTGAAAGACATACTGCGCCGCAGCCCTGGCACAGGGGCCGGGCTCGCTGAAAAGAGCGACCGATGC
TCAGCCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302496
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302496.1, NP_001289425.1
RefSeq Size 1525 bp
RefSeq ORF 852 bp
Locus ID 14618
UniProt ID P28230
Gene Summary This gene is a member of the gap junction protein (connexin) family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of ions and small molecules between cells. Mutations in a similar gene in human cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All of the variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...