Tarbp2 (NM_001253795) Mouse Untagged Clone

CAT#: MC226720

Tarbp2 (untagged) - Mouse TAR (HIV) RNA binding protein 2 (Tarbp2), transcript variant 2



  "NM_001253795" in other vectors (1)

CNY 2,760.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Prbp; TRBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226720 representing NM_001253795
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGAAGAGGATCAGGGCTCCGGCACTACTACAGGCTGCGGGCTGCCCAGTTCTTTTTCTCTCCTAG
ACTCTTCACCGCCTGAGGACACTCCTGTCGTTGCTGCAGAAGCTGCTGCCCCTGTTCCATCTGCTGTACT
AACCAGGAGCCCTCCCATGGAGATGCAGCCCCCTGTCTCTCCTCAGCAGTCTGAGTGCAACCCCGTCGGT
GCTCTGCAGGAGCTGGTGGTGCAAAAAGGCTGGCGTTTGCCAGAGTACATGGTGACCCAAGAGTCTGGGC
CTGCTCACCGCAAAGAGTTCACCATGACTTGCCGGGTGGAGCGTTTCATTGAGATTGGCAGTGGCACTTC
CAAAAAGCTGGCAAAGCGTAACGCAGCAGCTAAGATGCTCCTTCGAGTGCACACTGTACCTCTGGATGCC
CGGGATGGCAATGAGGCAGAGCCTGATGACGATCATTTTTCCATTGGCGTGAGCTCCCGCCTGGATGGAC
TGAGGAATCGTGGGCCAGGCTGCACCTGGGATTCCTTGCGGAATTCTGTGGGAGAAAAGATCCTATCCCT
TCGCAGTTGCTCCGTGGGCTCTCTAGGGGCTCTGGGCTCTGCCTGCTGCAGTGTCCTCAGTGAGCTCTCT
GAGGAGCAGGCTTTCCATGTCAGCTATCTGGATATTGAGGAACTGAGCCTGAGTGGGCTCTGCCAGTGCC
TAGTGGAACTGTCCACCCAGCCAGCCACTGTGTGTTATGGTTCTGCAACCACCAGGGAGGCAGCCCGAGG
TGATGCTGCTCACCGCGCCCTACAGTACCTCAGGATCATGGCGGGTAGCAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253795
Insert Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253795.1, NP_001240724.1
RefSeq Size 1533 bp
RefSeq ORF 825 bp
Locus ID 21357
Gene Summary Required for formation of the RNA induced silencing complex (RISC). Component of the RISC loading complex (RLC), also known as the micro-RNA (miRNA) loading complex (miRLC), which is composed of DICER1, AGO2 and TARBP2. Within the RLC/miRLC, DICER1 and TARBP2 are required to process precursor miRNAs (pre-miRNAs) to mature miRNAs and then load them onto AGO2. AGO2 bound to the mature miRNA constitutes the minimal RISC and may subsequently dissociate from DICER1 and TARBP2. May also play a role in the production of short interfering RNAs (siRNAs) from double-stranded RNA (dsRNA) by DICER1 (By similarity). Binds in vitro to the PRM1 3' UTR. Seems to act as a repressor of translation (PubMed:8649414).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks two exons in the 5' coding region, which does not affect the reading frame, compared to variant 1. The resulting isoform (2) lacks an internal segment in the N-terminal region, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...