Ccnc (NM_001290420) Mouse Untagged Clone

CAT#: MC226682

Ccnc (untagged) - Mouse cyclin C (Ccnc), transcript variant 3



  "NM_001290420" in other vectors (1)

CNY 2,660.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI451004; AU020987; CG1C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226682 representing NM_001290420
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGGAACTTCTGGCAGAGCTCCCACTATTTGCAGTGGATTTTGGATAAACAAGATCTGTTGAAAG
AGCGCCAAAAGGACCTAAAGTTTCTCTCAGAAGAGGAGTATTGGAAGTTACAAATATTTTTTACAAATGT
TATCCAAGCATTAGGTGAACATCTTAAATTAAGACAACAAGTTATTGCTACTGCTACAGTCTATTTCAAG
AGATTCTATGCTAGGTATTCTCTGAAAAGTATAGATCCTGTATTAATGGCGCCTACATGTGTGTTTCTGG
CATCCAAAGTAGAGGAATTTGGTGTTGTCTCAAATACAAGATTGATTGCTGCTACTACTTCTGTATTAAA
AACTAGATTTTCATATGCTTTTCCAAAGGAATTTCCTTACAGGATGAATCATATACTAGAATGTGAATTT
TACCTCTTAGAATTAATGGACTGTTGCTTGATAGTGTATCATCCTTATAGACCTTTGCTCCAGTATGTGC
AGGACATGGGCCAGGAAGACGTGCTGCTTCCCCTTGCATGGAGGATAGTGAATGATACCTACAGGACGGA
TCTCTGTCTGCTGTACCCTCCGTTCATGATCGCTTTAGCTTGCCTACATGTAGCCTGTGTCGTACAACAG
AAAGATGCTAGACAGTGGTTTGCAGAACTTTCTGTGGATATGGAGAAGATTTTGGAAATAATCAGGGTTA
TTTTAAAACTGTATGAGCAGTGGAAGAATTTTGATGAGAGAAAAGAGATGGCAACTATTCTTAGTAAGAT
GCCGAAACCAAAACCACCTCCAAACAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290420
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290420.1, NP_001277349.1
RefSeq Size 1500 bp
RefSeq ORF 801 bp
Locus ID 51813
Gene Summary Component of the Mediator complex, a coactivator involved in regulated gene transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Binds to and activates cyclin-dependent kinase CDK8 that phosphorylates the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAp II), which may inhibit the formation of a transcription initiation complex (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 3' terminal exon, compared to variant 1. It encodes isoform 3, which has a shorter C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...