Cpa6 (NM_001289497) Mouse Untagged Clone

CAT#: MC226649

Cpa6 (untagged) - Mouse carboxypeptidase A6 (Cpa6), transcript variant 2



  "NM_001289497" in other vectors (1)

CNY 2,660.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9030616D13Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226649 representing NM_001289497
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCTGGGCAGAAAATCACGAGCCTACAAAAGAGCTGTCTGGATAGACTGCGGCATTCACGCAAGAG
AATGGATCGGTCCTGCCTTTTGTCAGTGGTTTGTAAGAGAAGCCATTCTGACCTACAAGACTGACCCAGC
CATGAAAAAAATGTTGAATCATCTGTATTTCTATATCATGCCTGTATTCAATGTCGATGGATACCATTTC
AGCTGGACACATGATAGATTCTGGAGAAAGACCCGGTCAAGAGACTCTAAGTTTCGCTGTCGTGGAGTTG
ATGCCAATCGCAACTGGAAAGTGAAATGGTGCGATGAAGGAGCCTCCGCACACCCTTGTGATGATACATA
CTGTGGTCCTTTCCCAGAATCTGAACCAGAAGTGAAGGCTGTAGCTAACTTCCTTCGAAAACACAGAAAG
CGCATCAGGGCGTACCTGTCTTTTCATGCCTATGCTCAGATGTTGCTATATCCTTATTCTTACAAATATG
CAACAATCCCCAATTTTAGCTGTGTGGAATTTGCAGCTCACAAAGCTGTGAAGGCACTTCGGTCGGTACA
TGGGATCCGATACAGACATGGCCCCGCCTCCCAAACACTGTATGTAAGCTCTGGTAACTCAATGGATTGG
GCTTATAAAAATGGAATACCCTATGCATTTGCTTTTGAACTGCGAGACACTGGGCATTTTGGATTTCTAC
TGCCAGAGATGCTCATTAAACCCACCTGCACAGAGACCATGCTGGCTGTGAAGAATATCACAATGCACCT
GCTAAAGAAATGTCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289497
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289497.1, NP_001276426.1
RefSeq Size 1815 bp
RefSeq ORF 789 bp
Locus ID 329093
UniProt ID Q5U901
Gene Summary This gene encodes a protein that belongs to the metallocarboxypeptidase family of proteins that catalyze the release of a C-terminal amino acid from the target protein. The encoded preproprotein undergoes proteolytic cleavage to yield the mature form which is thought to play a role in cell migration. In humans, this protein regulates neuropeptides in the brain and mutations in this gene are associated with a recessive familial form of febrile seizures and with temporal lobe epilepsy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks an in-frame portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...