Ldhb (NM_001302765) Mouse Untagged Clone

CAT#: MC226635

Ldhb (untagged) - Mouse lactate dehydrogenase B (Ldhb), transcript variant 2



  "NM_001302765" in other vectors (1)

CNY 2,570.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
LDHB Antibody - middlel region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI790582; H-Ld; H-Ldh; Ldh-; Ldh-2; LDH-B; LDH-H; Ldh2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226635 representing NM_001302765
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAACCCTTAAGGAGAAGCTCATTGCGTCCGTTGCAGATGATGAGGCTGCCGTCCCGAACAACAAGA
TCACTGTAGTGGGCGTTGGACAAGTGGGTATGGCATGTGCCATCAGCATTCTGGGAAAGTCTCTGGCTGA
TGAACTTGCCCTGGTGGATGTGTTGGAAGACAAGCTCAAAGGAGAGATGATGGACCTGCAGCACGGGAGC
TTGTTCCTCCAGACTCCGAAAATTGTGGCCGATAAAGATTACTCTGTGACAGCCAACTCTAAGATTGTGG
TGGTGACGGCAGGAGTCCGCCAGCAGGAGGGGGAGAGTCGGCTCAACCTGGTGCAGAGAAATGTCAACGT
GTTCAAGTTCATCATTCCTCAGATCGTCAAGTACAGCCCTGACTGCACCATCATCGTGGTTTCCAACCCA
GTGGATATTCTGACTTACGTCACCTGGAAACTGAGCGGGCTACCTAAGCACCGTGTGATTGGAAGCGGAT
GCAATCTGGATTCTGCTCGATTCCGCTACCTCATGGCAGAGAAGCTTGGCATTCATCCCAGCAGCTGCCA
CGGATGGATCCTGGGCGAGCATGGAGACTCCAGTGTGGCTGTGTGGAGCGGGGTGAATGTGGCAGGAGTC
TCCCTCCAGGAACTGAATCCAGAAATGGGGACAGACAATGACAGTGAGAACTGGAAGGAGGTGCATAAGA
TGGTGGTGGACAGGGAATGTACGGCATTGAGAATGAAGTCTTCCTCAGTCTCCCGTGCATCCTCAATGCT
CGGGGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302765
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302765.1, NP_001289694.1
RefSeq Size 1214 bp
RefSeq ORF 780 bp
Locus ID 16832
UniProt ID P16125
Gene Summary This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have also been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes 1 and 19. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift and a different 3' UTR compared to variant 1. The encoded isoform (2) is shorter with a distinct C-terminus compared to isoform Ldhb.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...