Mdfi (NM_001276390) Mouse Untagged Clone

CAT#: MC226540

Mdfi (untagged) - Mouse MyoD family inhibitor (Mdfi), transcript variant 3



  "NM_001276390" in other vectors (1)

CNY 2,380.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms I-mf; I-mfa
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226540 representing NM_001276390
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCAGGTGAGCGGTCAGTGCCCTTCTCGCTGCGACGCGCCTCATGGAGTCCCCAGCGCTGCCCTGG
ACCCAGCCCAGACCATGTCCCTCCTCCCTGGGCTGGAGGTAGCAAGATCCACTCACCCTGTAGAGGCATC
TTCTGAAGAGGGCTTCCCGGAGGAGGCGGCACCCTCCATGCCCCATGACAGTGGTCTCCGGGCTCAGCAG
GCTCTGAACAGCATTGACCTCGATGTCCCCACAGAAGCTGTGACGTGCCAGCCTCAAGGGAACCCCCAAG
GCTGCACCCCACTACTGCCAAATGGCTCCAGCCACGACCACCTCTCAGAACCGGGCAGTGCAGGGCATGC
GGGGAACGGTGCTCTGGGCGGGTCCAAGGCCCACCGGAAGTTGCAGACGCATCCATCTCTGGGCAGCCAG
GCTGGAAGGAAAAGCAGAGGCAGCGCCCGGTCAGCCTCACAGGTCCCTCTCCAGGCACAGGAAGATTGCT
GCGTCCACTGCATACTGTCCTGTCTATTCTGTGAGTTCCTGACGCTCTGTAACATCCTCCTGGACTGCGC
CACCTGTGGCTCCTGCAGCTCTGAGGACTCCTGCCTCTGCTGCTGCTGCTGTGGGTCCGGCGAGTGCGCG
GACTGTGACCTGCCCTGCGACCTGGACTGCGGCATCGTGGATGCCTGCTGCGAGTCCGCAGACTGCTTGG
AGATATGCATGGAGTGCTGTGGACTCTGTTTCTCCTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276390
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276390.1, NP_001263319.1
RefSeq Size 1593 bp
RefSeq ORF 741 bp
Locus ID 17240
UniProt ID P70331
Gene Summary Inhibits the transactivation activity of the Myod family of myogenic factors and represses myogenesis. Acts by associating with Myod family members and retaining them in the cytoplasm by masking their nuclear localization signals. Can also interfere with the DNA-binding activity of Myod family members. Plays an important role in trophoblast and chondrogenic differentiation. Regulates the transcriptional activity of TCF7L1/TCF3 by interacting directly with TCF7L1/TCF3 and preventing it from binding DNA. Binds to the axin complex, resulting in an increase in the level of free beta-catenin. Affects axin regulation of the WNT and JNK signaling pathways.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate 5' exon structure and differs in the 5' UTR compared to variant 2. Variants 1, 2 and 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...