Pld6 (NM_001290283) Mouse Untagged Clone

CAT#: MC226381

Pld6 (untagged) - Mouse phospholipase D family, member 6 (Pld6), transcript variant 1



  "NM_001290283" in other vectors (1)

CNY 2,190.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4933433K01Rik; Gm10; mitoPLD; mZuc; Zuc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226381 representing NM_001290283
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGCGCTCGAGTTGGCGGTTGGTGTTCGCGGCTGGTGCGGGTCTCGCGCTGGCCCTAGAGGCACTGC
CGTGGCTGATGCGTTGGCTGCTGGCTGGGCGGCGGCCAAGGCGCGAGGTGCTCTTCTTCCCCTCACAGGT
GACCTGCACCGAGGCTTTACTGCAGGCCCCAGGGTTGCCTCCCGGGCCCTCGGGCTGCCCGTGTAGCCTC
CCCCACAGCGAGAGTTCACTGAGCCGCCTGCTGCGCGCGCTGTTGGCCGCCCGCTCCAGCTTGGAGCTCT
GCCTCTTCGCCTTCTCCAGCCCGCAGCTGGGGCGTGCAGTGCAGCTGCTGCATCAGCGTGGGGTGCGCGT
GCGGGTCATCACTGACTGCGACTACATGGCCCTCAACGGCTCTCAGATCGGCCTGCTGCGCAAGGCAGGG
ATACAGGTACGGCACGACCAGGACCTAGGCTACATGCACCACAAGTTTGCCATCGTTGACAAGAAGGTGC
TCATCACCGGCTCCCTCAACTGGACCACACAGGCCATCCAGAACAACCGGGAGAACGTCCTGATTATGGA
GGACACCGAGTATGTGCGGCTGTTCCTGGAGGAGTTTGAGCGCATCTGGGAAGAATTTGACCCCACCAAG
TACAGCTTTTTCCCCCAAAAGCATCGAGGGCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290283
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290283.1, NP_001277212.1
RefSeq Size 1773 bp
RefSeq ORF 666 bp
Locus ID 194908
UniProt ID Q5SWZ9
Gene Summary Endonuclease that plays a critical role in PIWI-interacting RNA (piRNA) biogenesis during spermatogenesis. piRNAs provide essential protection against the activity of mobile genetic elements. piRNA-mediated transposon silencing is thus critical for maintaining genome stability, in particular in germline cells when transposons are mobilized as a consequence of wide-spread genomic demethylation (PubMed:23064227, PubMed:23064230). Has been proposed to act as a cardiolipin hydrolase to generate phosphatidic acid at mitochondrial surface (PubMed:21397847, PubMed:21397848). Although it cannot be excluded that it can act as a phospholipase in some circumstances, it should be noted that cardiolipin hydrolase activity is either undetectable in vitro, or very low. In addition, cardiolipin is almost exclusively found on the inner mitochondrial membrane, while PLD6 localizes to the outer mitochondrial membrane, facing the cytosol. Has been shown to be a backbone-non-specific, single strand-specific nuclease, cleaving either RNA or DNA substrates with similar affinity (PubMed:23064227, PubMed:23064230). Produces 5' phosphate and 3' hydroxyl termini, suggesting it could directly participate in the processing of primary piRNA transcripts (PubMed:23064230). Also acts as a regulator of mitochondrial shape through facilitating mitochondrial fusion (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...