Socs1 (NM_001271603) Mouse Untagged Clone

CAT#: MC226328

Socs1 (untagged) - Mouse suppressor of cytokine signaling 1 (Socs1), transcript variant 1



  "NM_001271603" in other vectors (1)

CNY 2,090.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cish1; Cish7; JAB; SOCS-1; SSI-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226328 representing NM_001271603
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTAGCACGCAACCAGGTGGCAGCCGACAATGCGATCTCCCCGGCAGCAGAGCCCCGACGGCGGTCAG
AGCCCTCCTCGTCCTCGTCTTCGTCCTCGCCAGCGGCCCCCGTGCGTCCCCGGCCCTGCCCGGCGGTCCC
AGCCCCAGCCCCTGGCGACACTCACTTCCGCACCTTCCGCTCCCACTCCGATTACCGGCGCATCACGCGG
ACCAGCGCGCTCCTGGACGCCTGCGGCTTCTATTGGGGACCCCTGAGCGTGCACGGGGCGCACGAGCGGC
TGCGTGCCGAGCCCGTGGGCACCTTCTTGGTGCGCGACAGTCGCCAACGGAACTGCTTCTTCGCGCTCAG
CGTGAAGATGGCTTCGGGCCCCACGAGCATCCGCGTGCACTTCCAGGCCGGCCGCTTCCACTTGGACGGC
AGCCGCGAGACCTTCGACTGCCTTTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGCATGTTGG
GGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGTCGCCAGCGCATCGTGGCCGCCGT
GGGTCGCGAGAACCTGGCGCGCATCCCTCTTAACCCGGTACTCCGTGACTACCTGAGTTCCTTCCCCTTC
CAGATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271603
Insert Size 639 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271603.1, NP_001258532.1
RefSeq Size 1340 bp
RefSeq ORF 639 bp
Locus ID 12703
UniProt ID O35716
Gene Summary SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS1 is involved in negative regulation of cytokines that signal through the JAK/STAT3 pathway. Through binding to JAKs, inhibits their kinase activity. In vitro, also suppresses Tec protein-tyrosine activity (By similarity). Appears to be a major regulator of signaling by interleukin 6 (IL6) and leukemia inhibitory factor (LIF). Regulates interferon-gamma mediated sensory neuron survival. Probable substrate recognition component of an ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Seems to recognize JAK2 (By similarity). SOCS1 appears to be a negative regulator in IGF1R signaling pathway (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...