Cdc42 (NM_001243769) Mouse Untagged Clone

CAT#: MC226182

Cdc42 (untagged) - Mouse cell division cycle 42 (Cdc42), transcript variant 2



  "NM_001243769" in other vectors (1)

CN¥ 2,640.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI747189; AU018915
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226182 representing NM_001243769
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGACAATTAAGTGTGTTGTTGTTGGTGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACA
CAACAAACAAATTCCCATCGGAATATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGG
TGGAGAGCCATACACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGACTACGACCGCTA
AGTTATCCACAGACAGATGTTTTTCTAGTATGTTTCTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGA
AAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAAT
TGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATTACTCCAGAG
ACTGCTGAAAAGCTGGCGCGGGATCTGAAGGCTGTCAAGTATGTGGAGTGCTCTGCCCTCACACAGAGAG
GTCTGAAGAATGTGTTTGATGAGGCTATCCTAGCTGCCCTCGAGCCTCCGGAAACTCAACCCAAAAGGAA
GTGCTGTATATTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001243769
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243769.1, NP_001230698.1
RefSeq Size 1521 bp
RefSeq ORF 576 bp
Locus ID 12540
UniProt ID P60766
Gene Summary Plasma membrane-associated small GTPase which cycles between an active GTP-bound and an inactive GDP-bound state (PubMed:24352656). In its active state binds to a variety of effector proteins to regulate cellular responses. Involved in epithelial cell polarization processes. Regulates the bipolar attachment of spindle microtubules to kinetochores before chromosome congression in metaphase. Regulates cell migration (By similarity). In neurons, plays a role in the extension and maintenance of the formation of filopodia, thin and actin-rich surface projections. Required for DOCK10-mediated spine formation in Purkinje cells and hippocampal neurons (PubMed:25851601). Facilitates filopodia formation upon DOCK11-activation (PubMed:22494997). Upon activation by CaMKII, modulates dendritic spine structural plasticity by relaying CaMKII transient activation to synapse-specific, long-term signaling (By similarity). Also plays a role in phagocytosis through organization of the F-actin cytoskeleton associated with forming phagocytic cups (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2, which is the same length but has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...