Fxyd5 (NM_001287213) Mouse Untagged Clone

CAT#: MC226092

Fxyd5 (untagged) - Mouse FXYD domain-containing ion transport regulator 5 (Fxyd5), transcript variant 3



  "NM_001287213" in other vectors (1)

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms EF-8; Oi; Oit2; RIC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226092 representing NM_001287213
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCACTGTCCAGTCGCCTGTGTCTCCTCACTATTGTCGCCCTGATTCTGCCCAGCAGAGGGCAGACAC
CAAAAAAGCCCACATCCATTTTTACAGCGGACCAGACTTCTGCGACTACTCGTGACAATGTCCCAGATCC
AGATCAAACCAGCCCAGGAGTCCAGACCACCCCTCTCATCTGGACCAGAGAAGAAGCCACAGGAAGCCAG
ACAGCAGCCCAAACCGAGACCCAGCAACTGACAAAAATGGCCACCTCGAATCCAGTGTCAGATCCAGGGC
CACATACAAGCAGCAAGAAAGGTACCCCTGCAGTCTCCAGGATCGAGCCTCTCAGCCCATCCAAAAACTT
CATGCCTCCATCCTACATTGAACATCCACTGGATTCGAATGAGAACAACCCCTTCTACTACGATGATACT
ACCCTCCGGAAACGGGGACTGCTGGTGGCTGCGGTGCTGTTCATCACGGGAATTATCATTCTCACTAGTG
GGAAGTGTAGGCAGTTGTCTCAATTTTGCCTGAATCGCCACAGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001287213
Insert Size 537 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287213.1, NP_001274142.1
RefSeq Size 1037 bp
RefSeq ORF 537 bp
Locus ID 18301
UniProt ID P97808
Gene Summary This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...