Chtop (NM_001293781) Mouse Untagged Clone

CAT#: MC226087

Chtop (untagged) - Mouse chromatin target of PRMT1 (Chtop), transcript variant 7



  "NM_001293781" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2500003M10Rik; Fop; Srag
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226087 representing NM_001293781
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGAAGAACAAACAGCCGATGCCAGTGAATATTCGGGCTTCGATGCAGCAGCAGCAGCAGCTAGCCA
GTGCCAGAAACAGAAGACTGGCCCAGCAGATGGAGAATAGACCCTCTGTCCAGGCAGCATTAAAACTTAA
GCAGAGCTTAAAGCAGCGCCTGGGTAAGAGTAATATCCAGGCACGGTTAGGCCGACCCATAGGTGCCCTG
GCCAGGGGAGCAATTGGAGGAAGAGGCCTACCCATAATCCAGAGAGGCTTGCCCCGAGGAGGACTACGTG
GGGGACGTGCTACCAGAACCCTGCTTAGGGGTGGGATGTCGCTCCGAGGTCGGGGTATGATAGGTCGGGG
AAGAGGGGGCTTTGGAGGCAGAGGCCGAGGTCGTGGCCGAGGGAGAGGTGCCCTCACTCGCCCTGTATTG
ACCAAGGAGCAGCTGGACAACCAATTGGATGCATACATGTCGAAAACTAAAGGACACCTGGATGCTGAAT
TGGATGCCTACATGGCACAGACAGATCCTGAAACCAATGATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293781
Insert Size 534 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293781.1, NP_001280710.1
RefSeq Size 3580 bp
RefSeq ORF 534 bp
Locus ID 66511
UniProt ID Q9CY57
Gene Summary Plays an important role in the ligand-dependent activation of estrogen receptor target genes (By similarity). May play a role in the silencing of fetal globin genes (PubMed:20688955). Recruits the 5FMC complex to ZNF148, leading to desumoylation of ZNF148 and subsequent transactivation of ZNF148 target genes (PubMed:22872859). Required for the tumorigenicity of glioblastoma cells. Binds to 5-hydroxymethylcytosine (5hmC) and associates with the methylosome complex containing PRMT1, PRMT5, MEP50 and ERH. The CHTOP-methylosome complex associated with 5hmC methylates H4R3 and transactivates genes involved in glioblastomagenesis (PubMed:25284789).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) differs in the 5' UTR and has multiple differences in the coding region, but maintains the reading frame compared to variant 1. One of these differences results in translation initiation at a downstream start codon compared to variant 1. The encoded isoform (7) has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...