Ddit3 (NM_001290183) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	chop; CHOP-10; CHOP10; gadd153
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC226040 representing NM_001290183 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCTGAGTCCCTGCCTTTCACCTTGGAGACGGTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGG ATCTGCAGGAGGTCCTGTCCTCAGATGAAATTGGGGGCACCTATATCTCATCCCCAGGAAACGAAGAGGA AGAATCAAAAACCTTCACTACTCTTGACCCTGCGTCCCTAGCTTGGCTGACAGAGGAGCCAGGGCCAACA GAGGTCACACGCACATCCCAAAGCCCTCGCTCTCCAGATTCCAGTCAGAGTTCTATGGCCCAGGAGGAAG AGGAGGAAGAGCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGTGCCCAGCCCGGCCTGGGAAGCA ACGCATGAAGGAGAAGGAGCAGGAGAACGAGCGGAAAGTGGCACAGCTAGCTGAAGAGAACGAGCGGCTC AAGCAGGAAATCGAGCGCCTGACCAGGGAGGTGGAGACCACACGGCGGGCTCTGATCGACCGCATGGTCA GCCTGCACCAAGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001290183
Insert Size	507 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001290183.1, NP_001277112.1
RefSeq Size	840 bp
RefSeq ORF	507 bp
Locus ID	13198
UniProt ID	P35639
Gene Summary	Multifunctional transcription factor in ER stress response. Plays an essential role in the response to a wide variety of cell stresses and induces cell cycle arrest and apoptosis in response to ER stress. Plays a dual role both as an inhibitor of CCAAT/enhancer-binding protein (C/EBP) function and as an activator of other genes. Acts as a dominant-negative regulator of C/EBP-induced transcription: dimerizes with members of the C/EBP family, impairs their association with C/EBP binding sites in the promoter regions, and inhibits the expression of C/EBP regulated genes. Positively regulates the transcription of TRIB3, IL6, IL8, IL23, TNFRSF10B/DR5, PPP1R15A/GADD34, BBC3/PUMA, BCL2L11/BIM and ERO1L. Negatively regulates; expression of BCL2 and MYOD1, ATF4-dependent transcriptional activation of asparagine synthetase (ASNS), CEBPA-dependent transcriptional activation of hepcidin (HAMP) and CEBPB-mediated expression of peroxisome proliferator-activated receptor gamma (PPARG). Inhibits the canonical Wnt signaling pathway by binding to TCF7L2/TCF4, impairing its DNA-binding properties and repressing its transcriptional activity. Plays a regulatory role in the inflammatory response through the induction of caspase-11 (CASP4/CASP11) which induces the activation of caspase-1 (CASP1) and both these caspases increase the activation of pro-IL1B to mature IL1B which is involved in the inflammatory response. Acts as a major regulator of postnatal neovascularization through regulation of endothelial nitric oxide synthase (NOS3)-related signaling.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an internal exon in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.