Fabp5 (NM_001272097) Mouse Untagged Clone

CAT#: MC225837

Fabp5 (untagged) - Mouse fatty acid binding protein 5, epidermal (Fabp5), transcript variant 2



  "NM_001272097" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Fabp5 Antibody - C-terminal region
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms E-FABP; Fabpe; Kl; Klbp; ma; mal1; PA-FABP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225837 representing NM_001272097
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGTCTTAAGGATCTCGAAGGGAAGTGGCGCCTGATGGAAAGCCACGGCTTTGAGGAGTACATGA
AAGAGCTAGGAGTAGGACTGGCTCTTAGGAAGATGGCTGCCATGGCCAAGCCAGACTGTATCATTACGTG
TGATGGCAACAACATCACGGTCAAAACCGAGAGCACAGTGAAGACGACTGTGTTCTCTTGTAACCTGGGA
GAGAAGTTTGATGAAACGACAGCTGATGGCAGAAAAACTGAGACGGTCTGCACCTTCCAAGACGGTGCCC
TGGTCCAGCACCAGCAATGGGACGGGAAGGAGAGCACGATAACAAGAAAACTGAAGGATGGGAAGATGAT
CGTGTGTGTCATGAACAATGCCACCTGCACTCGGGTCTATGAGAAGGTGCAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001272097
Insert Size 405 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272097.1, NP_001259026.1
RefSeq Size 950 bp
RefSeq ORF 405 bp
Locus ID 16592
Gene Summary The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. In humans this gene has been associated with psoriasis and type 2 diabetes. In mouse deficiency of this gene in combination with a deficiency in Fabp4 confers protection against atherosclerosis, diet-induced obesity, insulin resistance and experimental autoimmune encephalomyelitis (the mouse model for multiple sclerosis). Alternative splicing results in multiple transcript variants that encode different protein isoforms. The mouse genome contains many pseudogenes similar to this locus. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (by one amino acid; isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...